Following is the list of genetic conditions that we can currently test for. Click on each one for further information (this is primarily for your physician). It may be possible to test for specicidic diagnositic test for other genetic conditions not in the list given below. If the conditioon you are looking for does not appear below, please contact us for more information.

Methylbutyryl Glycinuria

Condition Gene/ Varient
Methylbutyryl   Gene:HMGCL. Exons: NM_000191.2:1-9. Variants(2): c.835G>A

Glycinuria  c.122G>A

Hydroxy-3-methylglutaryl-CoA lyase deficiency

Condition Gene/Varient
Hydroxy-3-methylglutaryl-CoA lyase deficiency Gene:HMGCL. Exons: NM_000191.2:1-9. Variants(2): c.835G>A, c.122G>A

Hydroxyisobutryl-CoA Hydrolase Deficiency

Condition Gene/Varient
Hydroxyisobutryl-CoA Hydrolase Deficiency Gene:HIBCH. Exons: NM_014362.3:1-14. Variants(3): c.365A>G, c.220-9T>G, c.79- 3C>G

Methylcrotonyl-CoA Carboxylase 1 Deficiency

Condition Gene/Varient
Methylcrotonyl-CoA Carboxylase 1 Deficiency Gene:MCCC1. Exons: NM_020166.3:1-19. Variants(4): c.1310T>C, c.2079delA, c.1594G>C, c.1380T>G

Methylcrotonyl-CoA Carboxylase 2 Deficiency

Condition Gene/Varient
Methylcrotonyl-CoA Carboxylase 2 Deficiency Gene:MCCC2. Exons: NM_022132.4:1-17. Variants(7): c.464G>A, c.295G>C, c.517_518insT, c.929C>G, c.1015G>A, c.803G>C, c.838G>T

Methylglutaconic Aciduria Type 1

Condition Gene/Varient
Methylglutaconic Aciduria Type 1 Gene:AUH. Exons: NM_001698.2:1-10. Variants(5): c.589C>T, c.559G>A, c.991A>T, c.895- 1G>A, c.650G>A

Methylglutaconic Aciduria Type 31

Condition Gene/Varient
Methylglutaconic Aciduria Type 3 Gene:OPA3. Exons: NM_025136.3:1-2. Variants(1): c.143-1G>C 3

Methylglutaconic Aciduria Type 5

Condition Gene/Varient
Methylglutaconic Aciduria Type 5 Gene:DNAJC19. Exons: NM_145261.3:1-6. Variants(1): c.130-1G>C

ABCC8-Related Congenital Hyperinsulinism

Condition Gene/Varient
ABCC8-Related Congenital Hyperinsulinism Gene:ABCC8. Exons: NM_000352.3:1-39. Variants(5): c.3989-9G>A, c.560T>A, c.2147G>T, c.4160_4162delTCT, c.4307G>A

ABCD Syndrome

Condition Gene/Varient
ABCD Syndrome Gene:EDNRB. Exons: NM_000115.3:2-8. Variants(1): c.601C>T

Abetalipoproteinemia

Condition Gene/Varient
Abetalipoproteinemia Gene:MTTP. Exons: NM_000253.2:2-19. Variants(3): c.1769G>T, c.1619G>A, c.2593G>T

ACAD9 deficiency

Condition Gene/Varient
ACAD9 deficiency Gene:ACAD9. Exons: NM_014049.4:1-18. Variants(4): c.1594C>T, c.130T>A, c.1249C>T, c.797G>A

ACE-Related Renal Tubular Dysgenesis

Condition Gene/Varient
ACE-Related Renal Tubular Dysgenesis Gene:ACE. Exons: NM_000789.3:2-25. Variants(4): c.1486C>T, c.1319_1322delTGGA, c.798C>G, c.2371C>T A

Achondrogenesis Type 1B

Condition Gene/Varient
Achondrogenesis Type 1B Gene:SLC26A2. Exons: NM_000112.3:2-3. Variants(4): c.1020_1022delTGT, c.1273A>G, c.532C>T, c.2033G>T

Acrocallosal Syndrome

Condition Gene/Varient
Acrocallosal Syndrome Gene:KIF7. Exons: NM_198525.2:2-4,6-19. Variants(3): c.687delG, c.3001C>T, c.460C>T

Acyl-CoA Dehydrogenase Deficiency,Medium-Chain

Condition Gene/Varient
Acyl-CoA Dehydrogenase Deficiency,Medium-Chain Gene:ACADM. Exons: NM_000016.4:1-12. Variants(2): c.199T>C, c.985A>G Acyl-CoA

Dehydrogenase Deficiency,Very Long-Chain

Condition Gene/Varient
Dehydrogenase Deficiency,Very Long-Chain Gene:ACADVL. Exons: NM_000018.3:1-20. Variants(3): c.779C>T, c.848T>C, c.1322G>A

Adenosine Deaminase Deficiency

Condition Gene/Varient
Adenosine Deaminase Deficiency Gene:ADA. Exons: NM_000022.2:2-12. Variants(4): c.632G>A, c.226C>T, c.986C>T, c.320T>C

AGTR1-Related Renal Tubular Dysgenesis

Condition Gene/Varient
AGTR1-Related Renal Tubular Dysgenesis Deficiency Gene:AGTR1. Exons: NM_031850.3:3-4. Variants(1): c.215dupT

AGT-Related Renal Tubular Dysgenesis

Condition Gene/Varient
AGT-Related Renal Tubular Dysgenesis Gene:AGT. Exons: NM_000029.3:2-5. Variants(2): c.604C>T, c.1290delT

Aicardi-goutières Syndrome 1

Condition Gene/Varient
Aicardi-goutières Syndrome 1 Gene:TREX1. Exons: NM_033629.3:2. Variants(2): c.490C>T, c.341G>A

AICA-ribosiduria due to ATIC deficiency

Condition Gene/Varient
AICA-ribosiduria due to ATIC deficiency Gene:ATIC. Exons: NM_004044.6:2-16. Variants(1): c.1277A>G

Alkaptonuria

Condition Gene/Varient
Alkaptonuria Gene:HGD. Exons: NM_000187.3:1-14. Variants(11): c.688C>T, c.457_458insG, c.1111_1112insC, c.342+1G>A, c.808G>A, c.899T>G, c.175delA, c.1102A>G, c.360T>G, c.16-1G>A, c.481G>A

Alpha-Mannosidosis

Condition Gene/Varient
Alpha-Mannosidosis Gene:MAN2B1. Exons: NM_000528.3:1-24. Variants(7): c.215A>T, c.1067C>G, c.1830+1G>C, c.1915C>T, c.2278C>T, c.2426T>C, c.2248C>T

Alpha-Methylacyl-CoA Racemase Deficiency

Condition Gene/Varient
Alpha-Methylacyl-CoA Racemase Deficiency Gene:AMACR. Exons: NM_014324.5:1-5. Variants(1): c.154T>C

Alpha-thalassemia

Condition Gene/Varient
Alpha-thalassemia Gene:HBA1/HBA2. Variants(5): aa/-a3.7, aa/-a4.2, aa/-aSEA, aa/-aFIL, aa/-aTHAI

Alstrom Syndrome

Condition Gene/Varient
Alstrom Syndrome Gene:ALMS1. Exons: NM_015120.4:2-23. Variants(6): c.11449C>T, c.11316_11319delAGAG, c.8164C>T, c.8383C>T, c.10775delC, c.10483C>T

AMT-Related Glycine Encephalopathy

Condition Gene/Varient
AMT-Related Glycine Encephalopathy Gene:AMT. Exons: NM_000481.3:1-9. Variants(3): c.125A>G, c.139G>A, c.959G>A

Androgen Insensitivity Syndrome

Condition Gene/Varient
Androgen Insensitivity Syndrome Gene:AR. Exons: NM_000044.3:2-8. Variants(10): c.2650A>T, c.1769-11T>A, c.521T>G, c.2395C>G, c.340C>T, c.4G>A, c.1771A>T, c.2391G>A, c.2567G>A, c.2157G>A

Arginase Deficiency

Condition Gene/Varient
Arginase Deficiency Gene:ARG1. Exons: NM_000045.3:1-8. Variants(7): c.365G>A, c.871C>T, c.703G>C, c.413G>T, c.32T>C, c.869C>G, c.61C>T

Argininosuccinic Aciduria

Condition Gene/Varient
Argininosuccinic Aciduria Gene:ASL. Exons: NM_000048.3:2-17. Variants(8): c.35G>A, c.1060C>T, c.857A>G, c.1135C>T, c.532G>A, c.346C>T, c.1153C>T, c.283C>T

Aromatic L-Amino Acid Decarboxylase Deficiency

Condition Gene/Varient
Aromatic L-Amino Acid Decarboxylase Deficiency Gene:DDC. Exons: NM_000790.3:2-14. Variants(2): c.749C>T, c.304G>A

Arthrogryposis-Renal Dysfunction-Cholestasis 1

Condition Gene/Varient
Arthrogryposis-Renal Dysfunction-Cholestasis 1 Gene:VPS33B. Exons: NM_018668.3:1-23. Variants(3): c.1594C>T, c.89T>C, c.1312C>T

Aspartylglucosaminuria

Condition Gene/Varient
Aspartylglucosaminuria Gene:AGA. Exons: NM_000027.3:1-9. Variants(5): c.302C>T, c.488G>C, c.214T>C, c.904G>A, c.800dupT

Ataxia With Oculomotor Apraxia Type 1

Condition Gene/Varient
Ataxia With Oculomotor Apraxia Type 1 Gene:APTX. Exons: NM_175073.2:3-9. Variants(7): c.837G>A, c.875-1G>A, c.788T>G, c.602A>G, c.167delT, c.320delC, c.617C>T

Ataxia With Oculomotor Apraxia Type 2

Condition Gene/Varient
Ataxia With Oculomotor Apraxia Type 2 Gene:SETX. Exons: NM_015046.5:3-26. Variants(7): c.6638C>T, c.3880C>T, c.5927T>G, c.1027G>T, c.994C>T, c.2602C>T, c.4087C>T

Ataxia With Vitamin E Deficiency

Condition Gene/Varient
Ataxia With Oculomotor Apraxia Type 2 Gene:TTPA. Exons: NM_000370.3:25. Variants(5): c.485delG, c.513_514insTT, c.400C>T

Ataxia, Posterior Column, With Retinitis Pigmentosa

Condition Gene/Varient
Ataxia, Posterior Column, With Retinitis Pigmentosa Gene:FLVCR1. Exons: NM_014053.3:1-10. Variants(4): c.1477G>C, c.721G>A, c.361A>G, c.574T>C

Ataxia-telangiectasia

Condition Gene/Varient
Ataxia-telangiectasia Gene:ATM. Exons: NM_000051.3:2-63. Variants(11): c.7517_7520delGAGA, c.7967T>C, c.8030A>G, c.9139C>T, c.8480T>G, c.3245_3247delATCinsTGAT, c.103C>T, c.7875_7876delTGinsGC, c.5932G>T, c.5908C>T, c.3576G>A

Atelosteogenesis Type 2

Condition Gene/Varient
Atelosteogenesis Type 2 Gene:SLC26A2. Exons: NM_000112.3:2-3. Variants(4): c.1535C>A, c.835C>T, c.764G>A, c.2144C>T

ATP7A-Related Copper Transport Disorders

Condition Gene/Varient
ATP7A-Related Copper Transport Disorders Gene:ATP7A. Exons: NM_000052.5:2-23. Variants(7): c.3911A>G, c.601C>T, c.1910C>T, c.2938C>T, c.4156C>T, c.2981C>T, c.3056G>A

Autoimmune Polyendocrine Syndrome Type 1

Condition Gene/Varient
Autoimmune Polyendocrine Syndrome Type 1 Gene:AIRE. Exons: NM_000383.3:1-11,13-14. Variants(8): c.239T>G, c.1103_1104insC, c.247A>G, c.415C>T, c.1513delG, c.769C>T, c.254A>G, c.789delC

Autosomal Recessive Deafness 12

Condition Gene/Varient
Autosomal Recessive Deafness 12 Gene:CDH23. Exons: NM_022124.5:2-70. Variants(5): c.4021G>A, c.719C>T, c.902G>A, c.6442G>A, c.5663T>C

Autosomal Recessive Deafness 1A

Condition Gene/Varient
Autosomal Recessive Deafness 1A Gene:GJB2. Exons: NM_004004.5:2. Variants(58): c.340G>T, c.195C>G, c.134G>A, c.71G>A, c.533T>C, c.231G>A, c.56G>C, c.139G>T, c.416G>A, c.647_650delGATA, c.427C>T, c.35_36insC, c.268C>G, c.59T>C, c.358_360delGAG, c.269T>C, c.476A>T, c.617A>G, c.299_300delAT, c.334_335delAA, c.641T>C, c.408C>A, c.370C>T, c.638T>A, c.290_291insT, c.229T>C, c.398G>A, c.230G>A, c.614T>C, c.132G>A, c.283G>A, c.550C>T, c.523C>A, c.167delT, c.633T>A, c.44A>C, c.504_505insCCTT, c.572delT, c.94C>T, c.246C>G, c.508_509insT, c.169C>T, c.250G>C, c.119C>A, c.508_511dupAACG, c.428G>A, c.176_191delGCTGCAAGAACGTGTG, c.363delC, c.279G>A, c.516G>A, c.148G>A, c.439G>A, c.235delC, c.270dupA, c.518C>G, c.598G>A, c.1A>G, c.35delG

Autosomal Recessive Deafness 2

Condition Gene/Varient
Autosomal Recessive Deafness 2 Gene:MYO7A. Exons: NM_000260.3:2-49. Variants(5): c.1797G>A, c.133-2A>G, c.1184G>A, c.731G>C, c.3596dupT

Autosomal Recessive Deafness 21

Condition Gene/Varient
Autosomal Recessive Deafness 21 Gene:TECTA. Exons: NM_005422.2:1-23. Variants(3): c.6037delG, c.2941+1G>A, c.651_652insC

Autosomal Recessive Deafness 22

Condition Gene/Varient
Autosomal Recessive Deafness 22 Gene:OTOA. Exons: NM_144672.3:1-19. Variants(1): c.1320+2T>C

Autosomal Recessive Deafness 23

Condition Gene/Varient
Autosomal Recessive Deafness 23 Gene:PCDH15. Exons: NM_033056.3:2-33. Variants(3): c.785G>A, c.400C>G, c.1583T>A

Autosomal Recessive Deafness 24

Condition Gene/Varient
Autosomal Recessive Deafness 24 Gene:RDX. Exons: NM_002906.3:2-14. Variants(3): c.1405dupG, c.1732G>A, c.463C>T

Autosomal Recessive Deafness 25

Condition Gene/Varient
Autosomal Recessive Deafness 25 Gene:GRXCR1. Exons: NM_001080476.2:1-4. Variants(4): c.628-9C>A, c.412C>T, c.627+19A>T, c.229C>T

Autosomal Recessive Deafness 28

Condition Gene/Varient
Autosomal Recessive Deafness 28 Gene:TRIOBP. Exons: NM_001039141.2:3-6,8-17,19,21-23. Variants(6): c.3349C>T, c.1039C>T, c.2362C>T, c.1741C>T, c.889C>T, c.3202C>T

Autosomal Recessive Deafness 29

Condition Gene/Varient
Autosomal Recessive Deafness 29 Gene:CLDN14. Exons: NM_144492.2:3. Variants(3): c.254T>A, c.398delT, c.301G>A

Autosomal Recessive Deafness 3

Condition Gene/Varient
Autosomal Recessive Deafness 3 Gene:MYO15A. Exons: NM_016239.3:3-66. Variants(9): c.10573delA, c.8789-1G>C, c.5492G>T, c.3313G>T, c.3336delG, c.9958_9961delGACT, c.3756+1G>T, c.8148G>T, c.3685C>T

Autosomal Recessive Deafness 30

Condition Gene/Varient
Autosomal Recessive Deafness 30 Gene:MYO3A. Exons: NM_017433.4:3-35. Variants(3): c.1777-12G>A, c.732-2A>G, c.3129T>G

Autosomal Recessive Deafness 35

Condition Gene/Varient
Autosomal Recessive Deafness 35 Gene:ESRRB. Exons: NM_004452.3:4-11. Variants(2): c.1018_1024dupGAGTTTG, c.1024G>T

Autosomal Recessive Deafness 37

Condition Gene/Varient
Autosomal Recessive Deafness 37 Gene:MYO6. Exons: NM_004999.3:2-35. Variants(3): c.647A>T, c.3496C>T, c.36dupT

Autosomal Recessive Deafness 39

Condition Gene/Varient
Autosomal Recessive Deafness 39 Gene:HGF. Exons: NM_000601.4:1-18. Variants(1): c.495G>A

Autosomal Recessive Deafness 4, with Enlarged Vestibular Aqueduct

Condition Gene/Varient
Autosomal Recessive Deafness 4, with Enlarged Vestibular Aqueduct Gene:SLC26A4. Exons: NM_000441.1:3-21. Variants(94): c.1803G>A, c.2219G>T, c.1334T>G, c.1341+1delG, c.322delC, c.919-2A>G, c.2228T>A, c.1595G>T, c.916dupG, c.170C>A, c.1863delT, c.2168A>G, c.941C>A, c.1001+1G>A, c.281C>T, c.783_784insT, c.754T>C, c.2089+1G>A, c.440T>C, c.1160C>T, c.415+7A>G, c.1226G>A, c.1151A>G, c.1614+1G>A, c.2027T>A, c.1337A>G, c.1363A>T, c.1172G>A, c.2343A>G, c.1707+5G>A, c.589G>A, c.1246A>C, c.1409G>A, c.2173G>C, c.753_756delCTCT, c.1174A>T, c.365_366insT, c.304G>A, c.1198delT, c.1343C>T, c.707T>C, c.1588T>C, c.1229C>T, c.1615-1G>A, c.1975G>C, c.397T>A, c.626G>T, c.2080T>C, c.233A>G, c.1919G>A, c.395C>T, c.1105A>G, c.1541A>G, c.1589A>C, c.1149+3A>G, c.1079C>T, c.2127delT, c.2086C>T, c.1147delC, c.946G>T, c.-3-2A>G, c.230A>T, c.1392delG, c.1264-1G>C, c.165-1G>A, c.412G>T, c.716T>A, c.1667A>G, c.601-1G>A, c.918+1G>A, c.279T>A, c.1439T>A, c.2162C>T, c.1694G>A, c.1334_1335insAGTC, c.1371C>A, c.235C>T, c.2170G>A, c.407_411delTCTCA, c.2015G>A, c.665G>T, c.1985G>A, c.249G>A, c.269C>T, c.1536_1537delAG, c.890delC, c.2186T>C, c.279delT, c.129dupC, c.149T>G, c.68C>A, c.84C>A, c.85G>C, c.87G>C

Autosomal Recessive Deafness 49

Condition Gene/Varient
Autosomal Recessive Deafness 49 Gene:MARVELD2. Exons: NM_001038603.2:2-7. Variants(5): c.1331+1G>A, c.1183-1G>A, c.1498C>T, c.1331+2T>C, c.1331+2_1331+5delTGAG

Autosomal Recessive Deafness 59

Condition Gene/Varient
Autosomal Recessive Deafness 59 Gene:DFNB59. Exons: NM_001042702.3:2-7. Variants(7): c.988delG, c.726delT, c.161C>T, c.547C>T, c.499C>T, c.122delA, c.113dupT

Autosomal Recessive Deafness 6

Condition Gene/Varient
Autosomal Recessive Deafness 6 Gene:TMIE. Exons: NM_147196.2:2-4. Variants(3): c.170G>A, c.241C>T, c.250C>T

Autosomal Recessive Deafness 61

Condition Gene/Varient
Autosomal Recessive Deafness 61 Gene:SLC26A5. Exons: NM_198999.2:3-20. Variants(3): c.390A>C, c.209G>A, c.-53-2A>G

Autosomal Recessive Deafness 63

Condition Gene/Varient
Autosomal Recessive Deafness 63 Gene:LRTOMT. Exons: NM_001145308.4:3-7. Variants(5): c.242G>A, c.313T>C, c.333C>G, c.328G>A, c.358+4A>C

Autosomal Recessive Deafness 67

Condition Gene/Varient
Autosomal Recessive Deafness 67 Gene:LHFPL5. Exons: NM_182548.3:1-3. Variants(4): c.250delC, c.380A>G, c.649delG, c.494C>T

Autosomal Recessive Deafness 7/11

Condition Gene/Varient
Autosomal Recessive Deafness 7/11 Gene:TMC1. Exons: NM_138691.2:5-24. Variants(4): c.1543T>C, c.1960A>G, c.1165C>T, c.100C>T

Autosomal Recessive Deafness 77

Condition Gene/Varient
Autosomal Recessive Deafness 77 Gene:LOXHD1. Exons: NM_144612.6:1-40. Variants(2): c.4714C>T, c.2008C>T

Autosomal Recessive Deafness 79

Condition Gene/Varient
Autosomal Recessive Deafness 79 Gene:TPRN. Exons: NM_001128228.2:2-4. Variants(2): c.1427delC, c.1239G>A T

Autosomal Recessive Deafness 8/10

Condition Gene/Varient
Autosomal Recessive Deafness 8/10 Gene:TMPRSS3. Exons: NM_024022.2:2-13. Variants(4): c.647G>T, c.753G>C, c.208delC, c.1211C>T

Autosomal Recessive Deafness 9

Condition Gene/Varient
Autosomal Recessive Deafness 9 Gene:OTOF. Exons: NM_194248.2:1-46. Variants(8): c.1544T>C, c.3032T>C, c.1778delT, c.766- 2A>G, c.2485C>T, c.2348delG, c.4491T>A, c.5816G>A

Autosomal Recessive Distal Spinal Muscular Atrophy 1

Condition Gene/Varient
Autosomal Recessive Distal Spinal Muscular Atrophy 1 Gene:IGHMBP2. Exons: NM_002180.2:2-15. Variants(7): c.675delT, c.638A>G, c.1738G>A, c.121C>T, c.2362C>T, c.707T>G, c.2611+1G>T

Autosomal Recessive Distal Spinal Muscular Atrophy 4

Condition Gene/Varient
Autosomal Recessive Distal Spinal Muscular Atrophy 4 Gene:PLEKHG5. Exons: NM_020631.4:2-21. Variants(1): c.1940T>C

Autosomal Recessive Hypophosphatemic Rickets 1

Condition Gene/Varient
Autosomal Recessive Hypophosphatemic Rickets 1 Gene:DMP1. Exons: NM_004407.3:2-6. Variants(3): c.362delC, c.1A>G, c.55-1G>C

Autosomal Recessive Hypophosphatemic Rickets 2

Condition Gene/Varient
Autosomal Recessive Hypophosphatemic Rickets 2 Gene:ENPP1. Exons: NM_006208.2:2-25. Variants(2): c.2702A>C, c.797G>T C

Autosomal Recessive Neutropenia, Severe Congenital 4

Condition Gene/Varient
Autosomal Recessive Neutropenia, Severe Congenital 4 Gene:G6PC3. Exons: NM_138387.3:1-6. Variants(7): c.778G>C, c.758G>A, c.346A>G, c.141C>G, c.935_936insT, c.784G>C, c.554T>C

Autosomal Recessive Osteopetrosis 1

Condition Gene/Varient
Autosomal Recessive Osteopetrosis 1 Gene:TCIRG1. Exons: NM_006019.3:2-20. Variants(4): c.2236+1G>A, c.1331G>T, c.1213G>A, c.1392C>A

Autosomal Recessive Osteopetrosis 3

Condition Gene/Varient
Autosomal Recessive Osteopetrosis 3 Gene:CA2. Exons: NM_000067.2:2-7. Variants(3): c.232+1G>A, c.120T>G, c.319C>T

Autosomal Recessive Osteopetrosis 4

Condition Gene/Varient
Autosomal Recessive Osteopetrosis 4 Gene:CLCN7. Exons: NM_001287.5:2-25. Variants(3): c.2285G>A, c.1663C>T, c.2297T>C

Autosomal Recessive Osteopetrosis 5

Condition Gene/Varient
Autosomal Recessive Osteopetrosis 5 Gene:OSTM1. Exons: NM_014028.3:1-6. Variants(1): c.415_416delAG C

Autosomal Recessive Polycystic Kidney Disease

Condition Gene/Varient
Autosomal Recessive Polycystic Kidney Disease Gene:PKHD1. Exons: NM_138694.3:2-67. Variants(137): c.8579_8583delACAGT, c.711_714delAATG, c.1626_1629delACTT, c.9464A>G, c.10412T>G, c.10219C>T, c.528-2A>G, c.5323C>T, c.10136delC, c.8068T>C, c.10765C>T, c.5378_5380+1delATGG, c.737T>C, c.2269A>C, c.8588A>G, c.9707delC, c.4330C>T, c.10628_10635delTGTATGTT, c.6333-2A>G, c.10658T>C, c.1057C>T, c.2810G>A, c.3467C>T, c.5895dupA, c.8312T>A, c.2936C>T, c.1880T>A, c.2542T>A, c.982C>T, c.1095G>A, c.9348delG, c.5498C>T, c.6992T>A, c.9689delA, c.5993T>C, c.10728G>A, c.9765G>A, c.3306delT, c.2532C>A, c.7477C>T, c.3848C>A, c.664A>G, c.977G>T, c.7177C>T, c.9319C>T, c.5485C>T, c.10856delA, c.3958_3959delGG, c.4256_4257delGG, c.10637delT, c.5375delT, c.474G>A, c.3367G>A, c.6097A>G, c.6029delA, c.9861C>A, c.2279G>A, c.10240delA, c.6907A>T, c.107C>T, c.11074C>T, c.10364delC, c.11506+1G>A, c.9683C>A, c.3118C>T, c.2341C>T, c.11612G>A, c.8302+2T>C, c.1486C>T, c.383delC, c.5750A>C, c.10972_10973delAT, c.6209G>A, c.2520_2526delATACACT, c.7264T>G, c.8829_8830insG, c.5748_5749delTC, c.10031T>G, c.8011C>T, c.10077delG, c.1411_1412delGT, c.11524C>T, c.10637_10638insG, c.9718C>T, c.10444C>T, c.7916C>A, c.2264C>T, c.10174C>T, c.9719G>A, c.9239G>A, c.8909_8912delTTGT, c.8642+1G>A, c.7912-1G>C, c.8870T>C, c.3761_3762delCCinsG, c.2216C>T, c.7351-2A>T, c.53-3C>A, c.3229-2A>C, c.1418T>G, c.6929delG, c.2141-1G>T, c.881-1G>A, c.4870C>T, c.977-1G>A, c.4457C>T, c.5075G>A, c.9530T>C, c.353delG, c.2854G>A, c.5646delT, c.1690C>T, c.370C>T, c.5513A>G, c.2812_2813delTA, c.6296_6297delTG, c.8518C>T, c.1233+1G>A, c.8935C>T, c.5381-2A>C, c.3747T>G, c.9347delT, c.4220T>G, c.6383delT, c.976+2T>A, c.1937G>A, c.8114delG, c.5825A>G, c.9370C>T, c.4751G>T, c.1774C>T, c.5237-1G>A, c.1830T>A, c.2179_2180insT, c.3364G>A, c.10709C>G, c.8824C>T

Autosomal Recessive Segawa Syndrome

Condition Gene/Varient
Autosomal Recessive Segawa Syndrome Gene:TH. Exons: NM_000360.3:1-13. Variants(6): c.605G>A, c.614T>C, c.1388C>T, c.917G>A, c.1141C>A, c.733A>C

Autosomal Recessive Spastic Ataxia of Charlevoix-Saguenay

Condition Gene/Varient
Autosomal Recessive Spastic Ataxia of Charlevoix-Saguenay Gene:SACS. Exons: NM_014363.4:2,4-10. Variants(4): c.8844delT, c.7504C>T, c.12160C>T, c.10907G>A

Autosomal Recessive Spastic paraplegia 11

Condition Gene/Varient
Autosomal Recessive Spastic paraplegia 11 Gene:SPG11. Exons: NM_025137.3:1-40. Variants(8): c.6100C>T, c.733_734delAT, c.7152- 1G>C, c.5623C>T, c.2472_2473insT, c.529_533delATATT, c.442+1G>C, c.118C>T

Autosomal Recessive Spastic paraplegia 15

Condition Gene/Varient
Autosomal Recessive Spastic paraplegia 15 Gene:ZFYVE26. Exons: NM_015346.3:2-42. Variants(4): c.5485-1G>A, c.5422C>T, c.4312C>T, c.1477C>T

Autosomal Recessive Spastic paraplegia 20

Condition Gene/Varient
Autosomal Recessive Spastic paraplegia 20 Gene:SPG20. Exons: NM_015087.4:2-9. Variants(2): c.364_365delAT, c.1110delA

Autosomal Recessive Spastic paraplegia 7

Condition Gene/Varient
Autosomal Recessive Spastic paraplegia 7 Gene:SPG7. Exons: NM_003119.2:2-17. Variants(10): c.1617delC, c.2216_2217insA, c.1045G>A, c.1529C>T, c.1749G>C, c.1742_1744delTGG, c.850_851delTTinsC, c.233T>A, c.784_785delGC, c.2075G>C

Bardet-Biedl syndrome 1

Condition Gene/Varient
Bardet-Biedl syndrome 1 Gene:BBS1. Exons: NM_024649.4:1-17. Variants(1): c.1169T>G Bardet-Biedl syndrome 10. Gene:BBS10. Exons: NM_024685.3:1-2. Variants(1): c.217_218insT

Bartter Syndrome Type 1

Condition Gene/Varient
Bartter Syndrome Type 1 Gene:SLC12A1. Exons: NM_000338.2:2-27. Variants(3): c.1942G>A, c.814G>T, c.1875G>A Bartter Syndrome Type 2. Gene:KCNJ1. Exons: NM_000220.3:1-2. Variants(8): c.592G>A, c.641C>T, c.372T>A, c.500G>A, c.237C>G, c.657C>G, c.80G>A, c.322G>C

Bartter Syndrome Type 4A

Condition Gene/Varient
Bartter Syndrome Type 4A Gene:BSND. Exons: NM_057176.2:1-4. Variants(8): c.139G>A, c.28G>A, c.3G>A, c.35T>C, c.1A>T, c.23G>T, c.10G>T, c.22C>T

Bestrophinopathy

Condition Gene/Varient
Bestrophinopathy Gene:BEST1. Exons: NM_004183.3:2-11. Variants(4): c.422G>A, c.122T>C, c.949G>A, c.598C>T

Beta-Ketothiolase Deficiency

Condition Gene/Varient
Beta-Ketothiolase Deficiency Gene:ACAT1. Exons: NM_000019.3:1-12. Variants(11): c.433C>G, c.2T>A, c.935T>C, c.1083dupA, c.997G>C, c.814C>T, c.1136G>T, c.547G>A, c.1035_1037delAGA, c.1138G>A, c.278A>G T

Beta-thalassemia

Condition Gene/Varient
Beta-thalassemia Gene:HBB. Exons: NM_000518.4:1-3. Variants(110): c.216_217insT, c.79G>A, c.170G>A, c.316-3C>A, c.20A>T, c.364G>A, c.316-106C>G, c.4delG, c.111_118delTTGGACCC, c.1A>G, c.27dupG, c.52A>T, c.19G>T, c.92+5G>C, c.226delC, c.59A>G, c.92+5G>T, c.212C>G, c.215_216insA, c.114_120delGACCCAG, c.93-1G>C, c.315+1G>A, c.176_177insC, c.113G>A, c.92+1G>T, c.316- 14T>G, c.110delC, c.22_24delGAG, c.92+2T>A, c.2T>A, c.3G>T, c.230delC, c.108C>A, c.74delGinsCAC, c.82G>T, c.165delT, c.94delC, c.316-2A>G, c.93-3T>G, c.316-146T>G, c.349_350insTGAT, c.17_18delCT, c.332T>C, c.68_74delAAGTTGG, c.316-2A>C, c.2T>G, c.112delT, c.316-197C>T, c.-50-u30T>A, c.25_26delAA, c.47G>A, c.92G>C, c.189_195delTCATGGC, c.2T>C, c.315+1G>T, c.93-21G>A, c.36delT, c.-50-u31A>G, c.77_79delGTG, c.19G>A, c.380T>G, c.85_86insC, c.322_323insC, c.48G>A, c.364G>C, c.-50-u29A>G, c.425_433delTGGCCCACA, c.138delT, c.316-7C>G, c.75T>A, c.315+2delT, c.-43C>T, c.20delA, c.54_59delGGTGAA, c.92+1G>A, c.316-1G>T, c.287_288insA, c.78dupT, c.114G>A, c.118C>T, c.92+2T>C, c.3G>C, c.*110_*111delTA, c.92+6T>C, c.28_29insTA, c.315+1G>C, c.93-2A>G, c.-50-u28A>G, c.-50-u87C>T, c.-29G>A, c.-50-u87C>G, c.380T>A, c.93-1G>A, c.*110T>C, c.203_204delTG, c.135delC, c.126_129delCTTT, c.79G>T, c.67G>T, c.143_146dupATCT, c.184A>T, c.-50A>C, c.235delC, c.3G>A, c.45dupG, c.93-2A>C, c.92+2T>G, c.92+5G>A, c.178A>T, c.217dupA

Bietti Crystalline Dystrophy

Condition Gene/Varient
Bietti Crystalline Dystrophy Gene:CYP4V2. Exons: NM_207352.3:2-11. Variants(2): c.327+1G>A, c.1091-2A>G

Biotinidase Deficiency

Condition Gene/Varient
Biotinidase Deficiency Gene:BTD. Exons: NM_000060.2:1-4. Variants(8): c.1612C>T, c.235C>T, c.100G>A, c.1595C>T, c.511G>A, c.755A>G, c.98_104delGCGGCTGinsTCC, c.1368A>C

Bjornstad Syndrome

Condition Gene/Varient
Bjornstad Syndrome Gene:BCS1L. Exons: NM_004328.4:3-9. Variants(3): c.548G>A, c.103G>C, c.550C>T

Bloom syndrome

Condition Gene/Varient
Bloom syndrome Gene:BLM. Exons: NM_000057.2:2-22. Variants(1): c.2207_2212delATCTGAinsTAGATTC T

Bothnia Type Retinitis Pigmentosa

Condition Gene/Varient
Bothnia Type Retinitis Pigmentosa Gene:RLBP1. Exons: NM_000326.4:3-9. Variants(1): c.700C>T

Brittle Cornea Syndrome

Condition Gene/Varient
Brittle Cornea Syndrome Gene:ZNF469. Exons: NM_001127464.1:1-2. Variants(1): c.4174G>T

C3 deficiency

Condition Gene/Varient
C3 deficiency Gene:C3. Exons: NM_000064.2:1-41. Variants(5): c.1004-2A>T, c.2354+1G>A, c.3116dupT, c.1655G>A, c.1119+1G>T

Canavan Disease

Condition Gene/Varient
Canavan Disease Gene:ASPA. Exons: NM_000049.2:1-6. Variants(5): c.654C>A, c.433-2A>G, c.854A>C, c.693C>A, c.914C>A

CARASIL Syndrome

Condition Gene/Varient
CARASIL Syndrome Gene:HTRA1. Exons: NM_002775.4:2-9. Variants(4): c.1108C>T, c.904C>T, c.889G>A, c.754G>A

Carbamoylphosphate Synthetase I Deficiency

Condition Gene/Varient
Carbamoylphosphate Synthetase I Deficiency Gene:CPS1. Exons: NM_001875.4:1-38. Variants(5): c.130C>T, c.1631C>T, c.2945G>A, c.2359C>T, c.1010A>G

Carnitine Palmitoyltransferase I Deficiency

Condition Gene/Varient
Carnitine Palmitoyltransferase I Deficiency Gene:CPT1A. Exons: NM_001876.3:2-19. Variants(6): c.1493A>G, c.1361A>G, c.1079A>G, c.298C>T, c.2126G>A, c.1241C>T

Carnitine Palmitoyltransferase II Deficiency

Condition Gene/Varient
Carnitine Palmitoyltransferase II Deficiency Gene:CPT2. Exons: NM_000098.2:1-5. Variants(11): c.1657G>A, c.1891C>T, c.452G>A, c.520G>A, c.359A>G, c.1507C>T, c.1148T>A, c.680C>T, c.338C>T, c.1883A>C, c.370C>T

Carpenter Syndrome

Condition Gene/Varient
Carpenter Syndrome Gene:RAB23. Exons: NM_183227.1:2-7. Variants(1): c.434T>

A Cartilage-hair hypoplasia

Condition Gene/Varient
A Cartilage-hair hypoplasia Gene:RMRP. Exons: NR_003051.3:1. Variants(1): n.71A>G

CC2D2A-Related COACH Syndrome

Condition Gene/Varient
CC2D2A-Related COACH Syndrome Gene:CC2D2A. Exons: NM_001080522.2:3-38. Variants(1): c.3145C>T

Central Core Disease

Condition Gene/Varient
Central Core Disease Gene:RYR1. Exons: NM_000540.2:1-90,92-106. Variants(2): c.14545G>A, c.10579C>T

Cerebral Dysgenesis, Neuropathy, Ichthyosis, And Palmoplantar Keratoderma Syndrome

Condition Gene/Varient
Cerebral Dysgenesis, Neuropathy, Ichthyosis, And Palmoplantar Keratoderma Gene:SNAP29. Exons: NM_004782.3:1- 5. Variants(1): c.487dupA

Cerebrooculofacioskeletal Syndrome 1

Condition Gene/Varient
Cerebrooculofacioskeletal Syndrome 1 Gene:ERCC6. Exons: NM_000124.2:2-21. Variants(2): c.2047C>T, c.3862C>T

Cerebrotendinous xanthomatosis

Condition Gene/Varient
Cerebrotendinous xanthomatosis Gene:CYP27A1. Exons: NM_000784.3:1-9. Variants(6): c.1435C>G, c.1016C>T, c.1421G>A, c.1420C>T, c.434G>A, c.1214G>A

Charcot-Marie-Tooth disease Type 1F/Type 2E

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 1F/Type 2E Gene:NEFL. Exons: NM_006158.3:1-4. Variants(2): c.628G>T, c.418G>T

Charcot-Marie-Tooth disease Type 2B1

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 2B1 Gene:LMNA. Exons: NM_170707.3:1-12. Variants(1): c.892C>T

Charcot-Marie-Tooth disease Type 2B2

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 2B2 Gene:MED25. Exons: NM_030973.3:1-18. Variants(1): c.1004C>T

Charcot-Marie-Tooth disease Type 4A

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4A Gene:GDAP1. Exons: NM_018972.2:1-6. Variants(5): c.581C>G, c.92G>A, c.715C>T, c.844C>T, c.487C>T

Charcot-Marie-Tooth disease Type 4B1

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4B1 Gene:MTMR2. Exons: NM_016156.5:1-15. Variants(3): c.1276C>T, c.826G>T, c.1444C>T

Charcot-Marie-Tooth disease Type 4B2

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4B2 Gene:SBF2. Exons: NM_030962.3:2-40. Variants(3): c.1459C>T, c.3586C>T, c.2875C>T

Charcot-Marie-Tooth disease Type 4C

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4C Gene:SH3TC2. Exons: NM_024577.3:1-17. Variants(20): c.2710C>T, c.530-2A>G, c.3325C>T, c.3341delC, c.1982T>C, c.2829T>G, c.1178-1G>A, c.1747_1748delAG, c.3601C>T, c.217_227delGCTGCTCGGAGinsCCAGTAA, c.505T>C, c.2860C>T, c.2491_2492delAG, c.920G>A, c.1969G>A, c.3326G>C, c.1586G>A, c.2191delG, c.28delG, c.1972C>T

SectionCharcot-Marie-Tooth disease Type 4D

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4D Gene:NDRG1. Exons: NM_006096.3:2-16. Variants(2): c.442C>T, c.538-1G>A

Charcot-Marie-Tooth disease Type 4F

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4F Gene:PRX. Exons: NM_181882.2:4-7. Variants(5): c.2098delG, c.2145T>A, c.3208C>T, c.1951G>A, c.586C>T

Charcot-Marie-Tooth disease Type 4H

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4H Gene:FGD4. Exons: NM_139241.2:3-17. Variants(7): c.823C>T, c.893T>G, c.670C>T, c.1628_1629delAG, c.1756G>T, c.1325G>A, c.893T>C

Charcot-Marie-Tooth disease Type 4J

Condition Gene/Varient
Charcot-Marie-Tooth disease Type 4J Gene:FIG4. Exons: NM_014845.5:1-23. Variants(2): c.547C>T, c.122T>C

Chorea-Acanthocytosis

Condition Gene/Varient
Chorea-Acanthocytosis Gene:VPS13A. Exons: NM_033305.2:1-72. Variants(2): c.269T>A, c.622C>T

Citrullinemia Type I

Condition Gene/Varient
Citrullinemia Type I Gene:ASS1. Exons: NM_000050.4:3-16. Variants(13): c.910C>T, c.1085G>T, c.421-2A>G, c.970G>A, c.40G>A, c.794G>A, c.1168G>A, c.257G>A, c.835C>T, c.539G>A, c.470G>A, c.970+5G>A, c.1087C>T

Citrullinemia Type II

Condition Gene/Varient
Citrullinemia Type II Gene:SLC25A13. Exons: NM_014251.2:1-18. Variants(12): c.674C>A, c.1078C>T, c.852_855delTATG, c.1799dupA, c.1311+1G>A, c.615+1G>C, c.1801G>T, c.615+5G>A, c.1592G>A, c.1177+1G>A, c.1813C>T, c.1801G>A

Cockayne Syndrome Type A

Condition Gene/Varient
Cockayne Syndrome Type A Gene:ERCC8. Exons: NM_000082.3:1-12. Variants(3): c.37G>T, c.966C>A, c.479C>T

Cockayne Syndrome Type B

Condition Gene/Varient
Cockayne Syndrome Type B Gene:ERCC6. Exons: NM_000124.2:2-21. Variants(4): c.1550G>A, c.3592_3593insGA, c.2203C>T, c.1357C>T

Cohen syndrome

Condition Gene/Varient
Cohen syndrome Gene:VPS13B. Exons: NM_017890.4:2-62. Variants(1): c.3348_3349delCT

COL17A1-Related Junctional Epidermolysis Bullosa

Condition Gene/Varient
COL17A1-Related Junctional Epidermolysis Bullosa Gene:COL17A1. Exons: NM_000494.3:2-56. Variants(15): c.1706delC, c.3676C>T, c.433C>T, c.1898G>A, c.2336-2A>G, c.2944_2947+1delGAAGG, c.2383C>T, c.520_521delAG, c.2564T>G, c.2965delA, c.3908G>A, c.4003_4004delGG, c.4150_4151insG, c.2336-1G>T, c.3067C>T

COL4A3-Related Autosomal Recessive Alport Syndrome

Condition Gene/Varient
COL4A3-Related Autosomal Recessive Alport Syndrome Gene:COL4A3. Exons: NM_000091.4:2-52. Variants(3): c.4441C>T, c.4420_4424delCTTTT, c.4571C>G

COL4A4-Related Autosomal Recessive Alport Syndrome

Condition Gene/Varient
COL4A4-Related Autosomal Recessive Alport Syndrome Gene:COL4A4. Exons: NM_000092.4:2-48. Variants(5): c.3601G>A, c.4129C>T, c.3713C>A, c.4923C>A, c.4715C>T

Combined Oxidative Phosphorylation Deficiency 1

Condition Gene/Varient
Combined Oxidative Phosphorylation Deficiency 1 Gene:GFM1. Exons: NM_024996.5:1-18. Variants(3): c.1487T>G, c.748C>T, c.139C>T

Combined Oxidative Phosphorylation Deficiency 2

Condition Gene/Varient
Combined Oxidative Phosphorylation Deficiency 2 Gene:MRPS16. Exons: NM_016065.3:1-3. Variants(1): c.331C>T

Combined Oxidative Phosphorylation Deficiency 3

Condition Gene/Varient
Combined Oxidative Phosphorylation Deficiency 3 Gene:TSFM. Exons: NM_001172696.1:1-4,6-7. Variants(1): c.997C>T

Combined Oxidative Phosphorylation Deficiency 5

Condition Gene/Varient
Combined Oxidative Phosphorylation Deficiency 5 Gene:MRPS22. Exons: NM_020191.2:1-8. Variants(2): c.509G>A, c.644T>C

Combined pituitary hormone deficiency 1

Condition Gene/Varient
Combined pituitary hormone deficiency 1 Gene:POU1F1. Exons: NM_000306.2:1-6. Variants(10): c.472G>C, c.433A>T, c.515G>A, c.748G>T, c.514C>T, c.688G>A, c.577T>C, c.404T>G, c.428G>A, c.715C>T

Combined pituitary hormone deficiency 3

Condition Gene/Varient
Combined pituitary hormone deficiency 3 Gene:LHX3. Exons: NM_014564.3:2-3,5-6. Variants(3): c.347A>G, c.687G>A, c.644C>T

Combined pituitary hormone deficiency 2

Condition Gene/Varient
Combined pituitary hormone deficiency 2 Gene:PROP1. Exons: NM_006261.4:1-3. Variants(17): c.349T>A, c.150delA, c.263T>C, c.310delC, c.358C>T, c.343-11C>G, c.157delA, c.247C>T, c.218G>A, c.301_302delAG, c.469_470insT, c.109+1G>T, c.112_124delTCGAGTGCTCCAC, c.2T>C, c.373C>T, c.295C>T, c.217C>T

Combined SAP Deficiency

Condition Gene/Varient
Combined SAP Deficiency Gene:PSAP. Exons: NM_002778.2:1-14. Variants(1): c.1A

T Cone Dystrophy 4

Condition Gene/Varient
T Cone Dystrophy 4 Gene:PDE6C. Exons: NM_006204.3:1-22. Variants(12): c.85C>T, c.2457T>A, c.633G>C, c.256_257insAG, c.1483- 2A>G, c.826C>T, c.2368G>A, c.481-12T>A, c.967T>A, c.1805A>T, c.1682dupA, c.1363A>G

Cone-rod Dystrophy 3

Condition Gene/Varient
Cone-rod Dystrophy 3 Gene:ABCA4. Exons: NM_000350.2:1-50. Variants(6): c.2616_2617delCT, c.5714+5G>A, c.5285C>A, c.3540_3555delGTCTAAGGGTTTCTCC, c.2888delG, c.5461-10T>C

Congenital Amegakaryocytic Thrombocytopenia

Condition Gene/Varient
Congenital Amegakaryocytic Thrombocytopenia Gene:MPL. Exons: NM_005373.2:1-12. Variants(5): c.823C>A, c.1473G>A, c.769C>T, c.305G>C, c.556C>T

Congenital Bile Acid Synthesis Defect 4

Condition Gene/Varient
Congenital Bile Acid Synthesis Defect 4 Gene:AMACR. Exons: NM_014324.5:1-5. Variants(1): c.320T>C

Congenital Bile Acid Synthesis Defect 3

Condition Gene/Varient
Congenital Bile Acid Synthesis Defect 3 Gene:CYP7B1. Exons: NM_004820.3:2-6. Variants(1): c.1162C>T T

Congenital Diarrhea 4, Malabsorptive

Condition Gene/Varient
Congenital Diarrhea 4, Malabsorptive Gene:NEUROG3. Exons: NM_020999.3:2. Variants(2): c.278G>T, c.319C>A

Congenital Disorders of Glycosylation Ia

Condition Gene/Varient
Congenital Disorders of Glycosylation Ia Gene:PMM2. Exons: NM_000303.2:1-8. Variants(21): c.422G>A, c.669C>G, c.563A>G, c.338C>T, c.722G>C, c.691G>A, c.647A>T, c.95T>G, c.620T>C, c.484C>T, c.193G>T, c.677C>G, c.349G>C, c.131T>C, c.26G>A, c.385G>A, c.710C>G, c.357C>A, c.395T>C, c.368G>A, c.317A>T

Congenital Disorders of Glycosylation Ib

Condition Gene/Varient
Congenital Disorders of Glycosylation Ib Gene:MPI. Exons: NM_002435.1:1-8. Variants(4): c.656G>A, c.305C>T, c.413T>C, c.884G>A

Congenital Disorders of Glycosylation Ic

Condition Gene/Varient
Congenital Disorders of Glycosylation Ic Gene:ALG6. Exons: NM_013339.3:2-15. Variants(3): c.897_899delAAT, c.1432T>C, c.998C>T

Congenital Disorders of Glycosylation Ie

Condition Gene/Varient
Congenital Disorders of Glycosylation Ie Gene:DPM1. Exons: NM_003859.1:1-9. Variants(2): c.628delC, c.274C>G

Congenital Disorders of Glycosylation IIa

Condition Gene/Varient
Congenital Disorders of Glycosylation IIa Gene:MGAT2. Exons: NM_002408.3:1. Variants(3): c.869C>T, c.785A>G, c.1017T>A

Congenital Disorders of Glycosylation IIc

Condition Gene/Varient
Congenital Disorders of Glycosylation IIc Gene:SLC35C1. Exons: NM_018389.4:1-2. Variants(2): c.923C>G, c.439C>T

Congenital Disorders of Glycosylation IId

Condition Gene/Varient
Congenital Disorders of Glycosylation IId Gene:B4GALT1. Exons: NM_001497.3:1-6. Variants(1): c.1031dupC

Congenital Disorders of Glycosylation IIf

Condition Gene/Varient
Congenital Disorders of Glycosylation IIf Gene:SLC35A1. Exons: NM_006416.4:2-8. Variants(1): c.277_280delGTGCinsTG

Congenital Disorders of Glycosylation Ij

Condition Gene/Varient
Congenital Disorders of Glycosylation Ij Gene:DPAGT1. Exons: NM_001382.3:1-9. Variants(1): c.509A>G

Congenital Disorders of Glycosylation Ik

Condition Gene/Varient
Congenital Disorders of Glycosylation Ik Gene:ALG1. Exons: NM_019109.4:1-9,11,13. Variants(2): c.450C>G, c.434G>A

Congenital Disorders of Glycosylation It

Condition Gene/Varient
Congenital Disorders of Glycosylation It Gene:PGM1. Exons: NM_002633.2:1-11. Variants(2): c.361G>C, c.1507C>T

Congenital Erythropoietic Porphyria

Condition Gene/Varient
Congenital Erythropoietic Porphyria Gene:UROS. Exons: NM_000375.2:2-10. Variants(1): c.217T>C

Congenital Generalized Lipodystrophy Type 2

Condition Gene/Varient
Congenital Generalized Lipodystrophy Type 2 Gene:BSCL2. Exons: NM_032667.6:2-11. Variants(5): c.412C>T, c.823C>T, c.671+5G>A, c.672-3C>G, c.634G>C

Congenital Hypomyelinating Neuropathy 1

Condition Gene/Varient
Congenital Hypomyelinating Neuropathy 1 Gene:EGR2. Exons: NM_000399.3:1-2. Variants(1): c.803T>A

Congenital Hypothryoidism Nongoitrous 1

Condition Gene/Varient
Congenital Hypothryoidism Nongoitrous 1 Gene:TSHR. Exons: NM_000369.2:1-10. Variants(13): c.970C>T, c.1657G>A, c.1798T>C, c.122G>C, c.500T>A, c.1228G>A, c.928C>T, c.326G>A, c.484C>G, c.1637G>A, c.1170T>G, c.1575C>A, c.202C>T

Congenital Hypothryoidism Nongoitrous 4

Condition Gene/Varient
Congenital Hypothryoidism Nongoitrous 4 Gene:TSHB. Exons: NM_000549.3:2-3. Variants(3): c.205C>T, c.145G>A, c.94G>T

Congenital myasthenic Syndrome with tubular aggregates 2

Condition Gene/Varient
Congenital myasthenic Syndrome with tubular aggregates 2 Gene:DPAGT1. Exons: NM_001382.3:1-9. Variants(3): c.349G>A, c.358C>A, c.791T>G

Congenital Plasminogen Deficiency

Condition Gene/Varient
Congenital Plasminogen Deficiency Gene:PLG. Exons: NM_000301.3:1-18. Variants(6): c.112A>G, c.1848G>A, c.1120G>T, c.704G>A, c.693_695delGAA, c.1435G>T

Corneal Endothelial Dystrophy

Condition Gene/Varient
Corneal Endothelial Dystrophy Gene:SLC4A11. Exons: NM_032034.3:1-19. Variants(14): c.1813C>T, c.2240_2240+1insTATGACAC, c.637T>C, c.473_480delGCTTCGCC, c.2233_2240dupTATGACAC, c.2605C>T, c.2528T>C, c.1463G>A, c.1466C>T, c.1391G>A, c.2264G>A, c.353_356delAGAA, c.2606G>A, c.2566A>G

Crigler-Najjar Syndrome

Condition Gene/Varient
Crigler-Najjar Syndrome Gene:UGT1A1. Exons: NM_000463.2:1-5. Variants(5): c.674T>G, c.1021C>T, c.524T>A, c.44T>G, c.991C>T

Crisponi Syndrome

Condition Gene/Varient
Crisponi Syndrome Gene:CRLF1. Exons: NM_004750.4:2-6,8-9. Variants(12): c.538C>T, c.829C>T, c.413C>T, c.303delC, c.527+5G>A, c.713_714insC, c.852G>T, c.708_709delCCinsT, c.935G>A, c.845_846delTG, c.226T>G, c.676dupA

Cystic Fibrosis

Condition Gene/Varient
Crisponi Syndrome Gene:CFTR. Exons: NM_000492.3:1-27. Variants(151): c.1397C>A, c.3752G>A, c.579+1G>T, c.3937C>T, c.2583delT, c.1397C>G, c.1911delG, c.1209+1G>A, c.948delT, c.1130_1131insA, c.2834C>T, c.1007T>A, c.2668C>T, c.273+1G>A, c.3276C>G, c.3744delA, c.2464G>T, c.223C>T, c.3154T>G, c.328G>C, c.1680-1G>A, c.1766+1G>A, c.1A>G, c.3846G>A, c.3528delC, c.366T>A, c.2988G>A, c.2657+5G>A, c.803delA, c.200C>T, c.1865G>A, c.3310G>T, c.178G>T, c.2175_2176insA, c.3454G>C, c.1327_1330dupGATA, c.1766+3A>G, c.262_263delTT, c.164+12T>C, c.2551C>T, c.1022_1023insTC, c.3302T>A, c.2052delA, c.3276C>A, c.2780T>C, c.3873+1G>A, c.3230T>C, c.273+3A>C, c.3536_3539delCCAA, c.1585-8G>A, c.2538G>A, c.325_327delTATinsG, c.4077_4080delTGTTinsAA, c.489+1G>T, c.3197G>A, c.3587C>G, c.3140-26A>G, c.3717+4A>G, c.1393-1G>A, c.274G>A, c.1466C>A, c.1075C>A, c.613C>T, c.1572C>A, c.349C>T, c.2249C>T, c.115C>T, c.1055G>A, c.3659delC, c.3764C>A, c.292C>T, c.1675G>A, c.2537G>A, c.254G>A, c.1203G>A, c.350G>A, c.1079C>A, c.2128A>T, c.1202G>A, c.1766+1G>T, c.3612G>A, c.1679G>A, c.658C>T, c.4251delA, c.2491G>T, c.2052_2053insA, c.2988+1G>A, c.1645A>C, c.1081delT, c.3712C>T, c.3484C>T, c.1624G>T, c.1923_1931delCTCAAAACTinsA, c.595C>T, c.442delA, c.579+3A>G, c.1519_1521delATC, c.2125C>T, c.1654C>T, c.3196C>T, c.2051_2052delAAinsG, c.2490+1G>A, c.2453delT, c.617T>G, c.3909C>G, c.805_806delAT, c.1013C>T, c.3611G>A, c.3266G>A, c.1679G>C, c.2195T>G, c.580-1G>T, c.1585-1G>A, c.1477C>T, c.772A>G, c.1545_1546delTA, c.1475C>T, c.1766+5G>T, c.1647T>G, c.3773_3774insT, c.1558G>T, c.1156_1157insTA, c.2215delG, c.1364C>A, c.2875delG, c.2012delT, c.274-1G>A, c.1116+1G>A, c.1646G>A, c.988G>T, c.531delT, c.2989-1G>A, c.2290C>T, c.1438G>T, c.1040G>A, c.1721C>A, c.274G>T, c.1657C>T, c.1040G>C, c.722_743delGGAGAATGATGATGAAGTACAG, c.1652G>A, c.2039delC, c.3731G>A, c.3194T>C, c.1521_1523delCTT, c.2869_2870insG, c.3889_3890insT, c.579+5G>A, c.3472C>T, c.1753G>T, c.1000C>T

D-Hydroxyglutaric Aciduria

Condition Gene/Varient
D-Hydroxyglutaric Aciduria Gene:D2HGDH. Exons: NM_152783.3:2-10. Variants(3): c.491-2A>G, c.440T>G, c.1315A>G

D-Bifunctional Protein Deficiency

Condition Gene/Varient
D-Bifunctional Protein Deficiency Gene:HSD17B4. Exons: NM_000414.3:1-24. Variants(5): c.46G>A, c.423_424delGA, c.650A>G, c.1369A>T, c.317G>C

DCLRE1C-Related Omenn Syndrome

Condition Gene/Varient
DCLRE1C-Related Omenn Syndrome Gene:DCLRE1C. Exons: NM_001033855.1:1-7,9-14. Variants(1): c.2T>C

Dejerine-Sottas disease, autosomal recessive

Condition Gene/Varient
Dejerine-Sottas disease, autosomal recessive Gene:PRX. Exons: NM_181882.2:4-7. Variants(3): c.247delC, c.2857C>T, c.1102C>T

Dent Disease

Condition Gene/Varient
Dent Disease Gene:OCRL. Exons: NM_000276.3:2-24. Variants(2): c.166_167delAT, c.2530C>T

Diastrophic Dysplasia

Condition Gene/Varient
Diastrophic Dysplasia Gene:SLC26A2. Exons: NM_000112.3:2-3. Variants(4): c.1724delA, c.-26+2T>C, c.1361A>C, c.1957T>A

Dihydropyrimidine Dehydrogenase Deficiency

Condition Gene/Varient
Dihydropyrimidine Dehydrogenase Deficiency Gene:DPYD. Exons: NM_000110.3:1-23. Variants(1): c.1905+1G>A

Donnai-Barrow Syndrome

Condition Gene/Varient
Donnai-Barrow Syndrome Gene:LRP2. Exons: NM_004525.2:2-79. Variants(13): c.8519_8522delATTT, c.770-2A>G, c.1341+2T>G, c.9484_9485delGT, c.6160G>A, c.2640-1G>A, c.8452+1G>A, c.13139_13140insC, c.11469_11472delTTTG, c.10195C>T, c.7564T>C, c.9358_9359delAG, c.1093C>T

Donohue Syndrome

Condition Gene/Varient
Donohue Syndrome Gene:INSR. Exons: NM_000208.2:2-22. Variants(4): c.1114C>T, c.1378A>G, c.698T>C, c.172G>A

Duchenne Muscular Dystrophy

Condition Gene/Varient
Duchenne Muscular Dystrophy Gene:DMD. Exons: NM_004006.2:1-79. Variants(903): c.6223C>T, c.10018T>C, c.1332-9A>G, c.3121C>T, c.4558G>T, c.4711A>T, c.10019G>A, c.10033C>T, c.7339C>T, c.187-1G>C, c.8754delG, c.440C>A, c.8391-1G>C, c.3679C>T, c.5985T>G, c.1132C>T, c.2974C>T, c.7542+1G>A, c.7672C>T, c.3464_3471delGTTTGGAG, c.9663delA, c.9739C>T, c.3151C>T, c.903C>A, c.4841delG, c.10202T>G, c.8713C>T, c.2368C>T, c.7392delC, c.10606delC, c.1594C>T, c.9691C>T, c.2365G>T, c.5314A>T, c.6913-2A>G, c.5287C>T, c.3562A>T, c.357+1G>C, c.1633A>T, c.2776C>T, c.5401_5402delAT, c.409G>T, c.8686A>T, c.9649+2T>C, c.9001C>T, c.721C>T, c.1483-1G>C, c.1603-1G>A, c.748G>T, c.10554-2A>G, c.3259C>T, c.4898_4899delAG, c.7739delA, c.7873delC, c.3274A>T, c.10855C>T, c.9176delG, c.1978_1979delAA, c.1952G>A, c.10563delA, c.3365_3366delAG, c.2803+1G>A, c.1865C>G, c.9807+4delA, c.4057G>T, c.9974+2T>A, c.4084C>T, c.10141C>T, c.5563C>T, c.10094C>A, c.2866C>T, c.8938-9T>A, c.3427C>T, c.2991C>G, c.2638delC, c.1093C>T, c.745C>T, c.7542+2T>C, c.10135A>T, c.2475G>A, c.4087A>T, c.9600_9601delAA, c.3603+2T>G, c.4757G>A, c.9974+1G>T, c.488G>A, c.8176G>T, c.8774G>A, c.5800G>T, c.7247delT, c.6730C>T, c.313A>T, c.1324C>T, c.5209C>T, c.2128A>T, c.5266C>T, c.1527_1530delTCTC, c.2299G>T, c.9100C>T, c.3244G>T, c.4519-1G>C, c.8357G>A, c.9135delT, c.1873C>T, c.2407C>T, c.1663C>T, c.2281_2285delGAAAA, c.3430C>T, c.10088delC, c.4375C>T, c.2512C>T, c.4071+1G>A, c.1207G>T, c.2761delG, c.7229G>A, c.3125delA, c.6238C>T, c.2314G>T, c.7564C>T, c.2302C>T, c.8914C>T, c.6436A>T, c.689delT, c.9862G>T, c.6614+2T>C, c.6674T>G, c.5694_5697delAAAA, c.10477delC, c.4693C>T, c.3432+1G>T, c.10121delA, c.1615C>T, c.5845delC, c.5771_5772delAG, c.1555G>T, c.9649+5G>T, c.10219G>T, c.2956C>T, c.1235delT, c.6460C>T, c.9090delC, c.7054G>T, c.5637G>A, c.10651C>T, c.3470delA, c.1331+1G>T, c.7720C>T, c.4870C>T, c.2650C>T, c.1974delT, c.6200delC, c.2949+1G>T, c.7310- 1G>A, c.676_678delAAG, c.9148C>T, c.6804_6807delACAA, c.3478_3479delGT, c.1474C>T, c.10969G>T, c.9380C>G, c.3196G>T, c.453T>A, c.9183G>A, c.5032C>T, c.4980delG, c.7755G>A, c.580C>T, c.6276C>G, c.3397G>T, c.4545_4549delGAAGT, c.6277A>T, c.568C>T, c.8608C>T, c.6592C>T, c.10086+5G>C, c.53delA, c.31+1G>T, c.7657C>T, c.9337C>T, c.2558T>A, c.883C>T, c.1061G>A, c.6790C>T, c.1087C>T, c.8944C>T, c.9563+1215A>G, c.583C>T, c.4151delA, c.4103delG, c.4852C>T, c.8807_8808delTC, c.6255G>A, c.2707G>T, c.4150G>T, c.433C>T, c.3033delC, c.5272_5273delTC, c.1682G>A, c.1388G>A, c.5653C>T, c.10279C>T, c.2236G>T, c.10498_10499delAG, c.2968C>T, c.10003G>C, c.9403C>T, c.8416C>T, c.4294C>T, c.10108C>T, c.1292G>A, c.516delC, c.1726delT, c.3940C>T, c.6614+1G>A, c.2869C>T, c.6393_6394delAA, c.5917C>T, c.3768delG, c.5766_5770delGAAAG, c.6373C>T, c.956C>G, c.8443C>T, c.1783G>T, c.7309+1G>A, c.1489C>T, c.4996C>T, c.5740-2A>G, c.503C>A, c.7582G>T, c.6439-1G>A, c.2804-2A>C, c.178C>T, c.4845+2T>C, c.7768_7771delGAAG, c.475_476delTT, c.3220G>T, c.10072G>T, c.6423C>A, c.9197C>A, c.3086G>A, c.4918delA, c.5530C>T, c.10203delA, c.3268C>T, c.5350G>T, c.9361+5G>C, c.10223+1G>C, c.6880A>T, c.8087delT, c.8214G>A, c.2227C>T, c.4147C>T, c.11G>A, c.7348delG, c.1990C>T, c.2737delG, c.4071+2T>A, c.9360C>A, c.433delC, c.998C>A, c.5461G>T, c.9072G>A, c.6292C>T, c.4414C>T, c.2791G>T, c.673A>T, c.9364delG, c.9461T>A, c.3147delA, c.3336delG, c.724C>T, c.3603+1G>T, c.9928C>T, c.6943G>T, c.8269G>T, c.9619_9626delTGTAAAGC, c.7401_7402delGGinsAT, c.1812delC, c.4108C>T, c.253C>T, c.2293- 1G>T, c.9427C>T, c.6364G>T, c.58delA, c.572C>G, c.5154+2T>G, c.9986delT, c.965T>A, c.8074C>T, c.9959delC, c.10368delT, c.7105G>T, c.193G>T, c.10225_10229delCCCGT, c.9333delA, c.1619G>A, c.1149+2T>C, c.10722delC, c.8038C>T, c.2359delC, c.777delA, c.6955C>T, c.565C>T, c.10903C>T, c.9938G>T, c.9204_9207delCAAA, c.2701G>T, c.1683G>A, c.4518+5G>A, c.9649+1G>A, c.3469G>T, c.94-1G>A, c.772_773delCC, c.1533_1536delTCAC, c.8098A>T, c.1609G>T, c.8027+1G>A, c.7669delA, c.9563+1G>A, c.10171C>T, c.9109C>T, c.10126delC, c.2669T>G, c.530+1G>T, c.6391C>T, c.8728G>T, c.2276T>G, c.3188G>A, c.3337C>T, c.2622+1G>A, c.6720delT, c.6283C>T, c.2873C>G, c.3864delA, c.8287delC, c.2933_2934delGA, c.6544C>T, c.8064_8065delTA, c.9346C>T, c.832-15A>G, c.2017C>T, c.9748G>T, c.272T>A, c.5044G>T, c.5851C>T, c.6429G>A, c.5899C>T, c.1519delG, c.372delG, c.3222delA, c.9445C>T, c.354G>A, c.2665C>T, c.907C>T, c.5487_5488delAA, c.9568C>T, c.9471_9474delTTAT, c.8420G>A, c.1699G>T, c.2270C>G, c.2521C>T, c.3061G>T, c.4117C>T, c.5154+1G>A, c.5542A>T, c.2381-2A>G, c.4213C>T, c.1438G>T, c.3432+2240A>G, c.615T>A, c.5551C>T, c.649+2T>C, c.3347_3350delAGAA, c.5922+2T>C, c.5641C>T, c.2767delT, c.133C>T, c.8009G>A, c.6868A>T, c.9225-1G>A, c.4729C>T, c.3580C>T, c.10086+1G>T, c.199G>T, c.5554C>T, Exon 1-79 del, Exon 10- 11 del, Exon 10-13 del, Exon 10-17 del, Exon 10-18 del, Exon 10-23 del, Exon 10-30 del, Exon 10-33 del, Exon 10-42 del, Exon 10-43 del, Exon 10-44 del, Exon 10-46 del, Exon 10-48 del, Exon 10-53 del, Exon 10-62 del, Exon 11-13 del, Exon 11-41 del, Exon 11-48 del, Exon 1- 18 del, Exon 1-2 del, Exon 1-20 del, Exon 12-13 del, Exon 12-16 del, Exon 12-17 del, Exon 12-18 del, Exon 12-19 del, Exon 1-22 del, Exon 12-20 del, Exon 12-25 del, Exon 12-30 del, Exon 12-41 del, Exon 12-43 del, Exon 12-45 del, Exon 12-50 del, Exon 1-30 del, Exon 13-18 del, Exon 13-19 del, Exon 13-29 del, Exon 13-41 del, Exon 13-43 del, Exon 13-44 del, Exon 13-48 del, Exon 14-17 del, Exon 14-18 del, Exon 14- 43 del, Exon 14-60 del, Exon 1-5 del, Exon 1-6 del, Exon 16-17 del, Exon 16-19 del, Exon 16-27 del, Exon 16-44 del, Exon 1-7 del, Exon 17- 19 del, Exon 17-21 del, Exon 1-73 del, Exon 17-44 del, Exon 17-48 del, Exon 17-51 del, Exon 1-79 del, Exon 18-20 del, Exon 18-22 del, Exon 18-26 del, Exon 18-29 del, Exon 18-32 del, Exon 18-37 del, Exon 18-38 del, Exon 18-39 del, Exon 18-41 del, Exon 18-44 del, Exon 19- 20 del, Exon 19-21 del, Exon 19-44 del, Exon 20-21 del, Exon 20-22 del, Exon 20-23 del, Exon 20-26 del, Exon 20-29 del, Exon 20-37 del, Exon 20-41 del, Exon 20-43 del, Exon 20-45 del, Exon 20-47 del, Exon 20-50 del, Exon 2-12 del, Exon 2-13 del, Exon 21-42 del, Exon 21-43 del, Exon 2-17 del, Exon 2-18 del, Exon 2-19 del, Exon 2-20 del, Exon 22-25 del, Exon 22-30 del, Exon 22-31 del, Exon 22-33 del, Exon 22-37 del, Exon 22-41 del, Exon 22-47 del, Exon 2-29 del, Exon 2-30 del, Exon 24-26 del, Exon 24-27 del, Exon 2-44 del, Exon 2-6 del, Exon 26-43 del, Exon 26-44 del, Exon 2-7 del, Exon 28-49 del, Exon 30-42 del, Exon 3-11 del, Exon 3-12 del, Exon 3-13 del, Exon 31-40 del, Exon 31-43 del, Exon 3-15 del, Exon 31-57 del, Exon 3-16 del, Exon 3-17 del, Exon 3-19 del, Exon 3-20 del, Exon 3-21 del, Exon 3-24 del, Exon 3-25 del, Exon 3-26 del, Exon 3-27 del, Exon 3-28 del, Exon 3-29 del, Exon 3-30 del, Exon 3-34 del, Exon 33-43 del, Exon 33-45 del, Exon 3-37 del, Exon 3-4 del, Exon 3-41 del, Exon 3-42 del, Exon 3-43 del, Exon 3-44 del, Exon 35-42 del, Exon 35-43 del, Exon 35-44 del, Exon 35-45 del, Exon 3-6 del, Exon 3-7 del, Exon 37-43 del, Exon 3-8 del, Exon 38-43 del, Exon 39-43 del, Exon 4-12 del, Exon 4-13 del, Exon 4-17 del, Exon 4-18 del, Exon 4-19 del, Exon 4-22 del, Exon 42-43 del, Exon 42-45 del, Exon 42-50 del, Exon 42-53 del, Exon 4-30 del, Exon 43-50 del, Exon 43-51 del, Exon 43-52 del, Exon 44-45 del, Exon 44-47 del, Exon 44-49 del, Exon 44-51 del, Exon 44-52 del, Exon 44-53 del, Exon 44-55 del, Exon 44-60 del, Exon 45-46 del, Exon 45-47 del, Exon 45-48 del, Exon 45-49 del, Exon 45-50 del, Exon 45- 51 del, Exon 45-52 del, Exon 45-53 del, Exon 45-54 del, Exon 45-55 del, Exon 45-57 del, Exon 45-58 del, Exon 45-59 del, Exon 45-60 del, Exon 45-62 del, Exon 45-79 del, Exon 4-6 del, Exon 46-47 del, Exon 46-48 del, Exon 46-49 del, Exon 46-50 del, Exon 46-51 del, Exon 46-52 del, Exon 46-53 del, Exon 46-54 del, Exon 46-55 del, Exon 46-60 del, Exon 4-7 del, Exon 47-48 del, Exon 47-49 del, Exon 47-50 del, Exon 47-51 del, Exon 47-52 del, Exon 47-53 del, Exon 47-55 del, Exon 48-49 del, Exon 48-50 del, Exon 48-51 del, Exon 48-52 del, Exon 48-53 del, Exon 48-54 del, Exon 4-9 del, Exon 49-50 del, Exon 49-51 del, Exon 49-52 del, Exon 49-53 del, Exon 49-54 del, Exon 49-57 del, Exon 50-51 del, Exon 50-52 del, Exon 50-53 del, Exon 50-54 del, Exon 50-56 del, Exon 50-59 del, Exon 5-13 del, Exon 51-52 del, Exon 51-53 del, Exon 51-54 del, Exon 51-55 del, Exon 51-60 del, Exon 5-18 del, Exon 52-53 del, Exon 52-55 del, Exon 52-59 del, Exon 52-60 del, Exon 52- 61 del, Exon 52-62 del, Exon 5-29 del, Exon 53-54 del, Exon 53-55 del, Exon 53-56 del, Exon 53-59 del, Exon 53-60 del, Exon 5-37 del, Exon 5-41 del, Exon 5-42 del, Exon 5-50 del, Exon 5-55 del, Exon 55-59 del, Exon 55-61 del, Exon 55-63 del, Exon 55-77 del, Exon 56-61 del, Exon 56-62 del, Exon 56-76 del, Exon 56-79 del, Exon 58-59 del, Exon 5-9 del, Exon 60-63 del, Exon 6-13 del, Exon 6-16 del, Exon 61- 62 del, Exon 61-63 del, Exon 61-64 del, Exon 61-67 del, Exon 6-17 del, Exon 61-79 del, Exon 6-19 del, Exon 6-27 del, Exon 63-79 del, Exon 64-67 del, Exon 64-79 del, Exon 65-67 del, Exon 65-76 del, Exon 6-7 del, Exon 67-69 del, Exon 67-71 del, Exon 6-8 del, Exon 68-73 del, Exon 71-74 del, Exon 72-79 del, Exon 7-28 del, Exon 7-29 del, Exon 73-76 del, Exon 75-76 del, Exon 75-79 del, Exon 7-8 del, Exon 8-11 del, Exon 8-12 del, Exon 8-13 del, Exon 8-15 del, Exon 8-16 del, Exon 8-18 del, Exon 8-19 del, Exon 8-20 del, Exon 8-21 del, Exon 8-22 del, Exon 8-28 del, Exon 8-29 del, Exon 8-30 del, Exon 8-31 del, Exon 8-32 del, Exon 8-34 del, Exon 8-39 del, Exon 8-41 del, Exon 8-44 del, Exon 8-45 del, Exon 8-47 del, Exon 8-55 del, Exon 8-9 del, Exon 9-12 del, Exon 9-34 del, Exon 10-11 dup, Exon 10-16 dup, Exon 10-17 dup, Exon 10-18 dup, Exon 10-19 dup, Exon 10-44 dup, Exon 1-11 dup, Exon 11-40 dup, Exon 12-13 dup, Exon 12-15 dup, Exon 12-19 dup, Exon 12-20 dup, Exon 12-26 dup, Exon 12-30 dup, Exon 12-41 dup, Exon 12-44 dup, Exon 13-17 dup, Exon 13-19 dup, Exon 13-20 dup, Exon 13-29 dup, Exon 13-40 dup, Exon 13-42 dup, Exon 13-44 dup, Exon 1-40 dup, Exon 14-17 dup, Exon 14-18 dup, Exon 14-21 dup, Exon 14-32 dup, Exon 14-34 dup, Exon 14-42 dup, Exon 1-6 dup, Exon 16-17 dup, Exon 16-34 dup, Exon 16-41 dup, Exon 16-42 dup, Exon 17-18 dup, Exon 17-19 dup, Exon 17-41 dup, Exon 1-8 dup, Exon 18-23 dup, Exon 18-27 dup, Exon 18-29 dup, Exon 18-32 dup, Exon 18-33 dup, Exon 18-37 dup, Exon 18-38 dup, Exon 19-41 dup, Exon 19-43 dup, Exon 19-44 dup, Exon 19-45 dup, Exon 19-52 dup, Exon 20-21 dup, Exon 20-27 dup, Exon 20-29 dup, Exon 20-41 dup, Exon 20-43 dup, Exon 20-44 dup, Exon 2-10 dup, Exon 2-11 dup, Exon 21-29 dup, Exon 2-15 dup, Exon 22-25 dup, Exon 22-29 dup, Exon 22-41 dup, Exon 2-26 dup, Exon 2-29 dup, Exon 2-3 dup, Exon 2-33 dup, Exon 2-34 dup, Exon 2-4 dup, Exon 2-5 dup, Exon 2-6 dup, Exon 2-7 dup, Exon 27-30 dup, Exon 2-9 dup, Exon 29-43 dup, Exon 30-35 dup, Exon 30- 42 dup, Exon 30-43 dup, Exon 3-10 dup, Exon 3-11 dup, Exon 3-12 dup, Exon 3-13 dup, Exon 31-32 dup, Exon 31-45 dup, Exon 3-15 dup, Exon 3-16 dup, Exon 3-18 dup, Exon 3-19 dup, Exon 3-20 dup, Exon 3-25 dup, Exon 3-30 dup, Exon 33-34 dup, Exon 3-34 dup, Exon 33-44 dup, Exon 33-60 dup, Exon 3-38 dup, Exon 3-4 dup, Exon 3-41 dup, Exon 3-43 dup, Exon 3-44 dup, Exon 34-41 dup, Exon 3-5 dup, Exon 35-44 dup, Exon 3-6 dup, Exon 36-44 dup, Exon 3-7 dup, Exon 37-43 dup, Exon 3-8 dup, Exon 38-42 dup, Exon 38-44 dup, Exon 38-45 dup, Exon 3-9 dup, Exon 41-44 dup, Exon 4-17 dup, Exon 4-19 dup, Exon 42-43 dup, Exon 42-47 dup, Exon 43-44 dup, Exon 44-47 dup, Exon 44-49 dup, Exon 44-50 dup, Exon 44-52 dup, Exon 44-55 dup, Exon 44-57 dup, Exon 45-47 dup, Exon 45-49 dup, Exon 45-50 dup, Exon 45- 51 dup, Exon 45-52 dup, Exon 45-55 dup, Exon 45-56 dup, Exon 45-59 dup, Exon 45-61 dup, Exon 45-65 dup, Exon 46-47 dup, Exon 46-48 dup, Exon 46-49 dup, Exon 46-51 dup, Exon 46-52 dup, Exon 46-60 dup, Exon 47-49 dup, Exon 47-54 dup, Exon 48-49 dup, Exon 48-50 dup, Exon 48-52 dup, Exon 49-50 dup, Exon 49-51 dup, Exon 49-55 dup, Exon 49-60 dup, Exon 50-52 dup, Exon 50-54 dup, Exon 50-55 dup, Exon 50-59 dup, Exon 50-62 dup, Exon 5-11 dup, Exon 51-55 dup, Exon 51-57 dup, Exon 52-55 dup, Exon 52-60 dup, Exon 52-62 dup, Exon 5-27 dup, Exon 5-33 dup, Exon 53-54 dup, Exon 53-55 dup, Exon 53-60 dup, Exon 53-63 dup, Exon 5-41 dup, Exon 5-44 dup, Exon 54-57 dup, Exon 55-60 dup, Exon 55-63 dup, Exon 55-76 dup, Exon 5-6 dup, Exon 56-57 dup, Exon 56-61 dup, Exon 56-62 dup, Exon 56-63 dup, Exon 56-64 dup, Exon 56-66 dup, Exon 56-77 dup, Exon 5-7 dup, Exon 57-60 dup, Exon 58-63 dup, Exon 5-9 dup, Exon 61-62 dup, Exon 61-63 dup, Exon 61-64 dup, Exon 63-79 dup, Exon 64-67 dup, Exon 66-67 dup, Exon 6-67 dup, Exon 6-7 dup, Exon 69-79 dup, Exon 8-10 dup, Exon 8-11 dup, Exon 8-12 dup, Exon 8-13 dup, Exon 8-15 dup, Exon 8-16 dup, Exon 8-29 dup, Exon 8-30 dup, Exon 8-44 dup, Exon 8-9 dup, Exon 9-16 dup, Exon 9-41 dup

Dyskeratosis Congenita, Autosomal Recessive 1

Condition Gene/Varient
Dyskeratosis Congenita, Autosomal Recessive 1 Gene:NOP10. Exons: NM_018648.3:1-2. Variants(1): c.100C>T

Dyskeratosis Congenita, Autosomal Recessive 2

Condition Gene/Varient
Dyskeratosis Congenita, Autosomal Recessive 2 Gene:NHP2. Exons: NM_017838.3:1-4. Variants(2): c.460T>A, c.415T>C

Dyskeratosis Congenita, Autosomal Recessive 4

Condition Gene/Varient
Dyskeratosis Congenita, Autosomal Recessive 4 Gene:TERT. Exons: NM_198253.2:2-7,9-16. Variants(3): c.2110C>T, c.2431C>T, c.2701C>T

Dyskeratosis Congenita, X-linked

Condition Gene/Varient
Dyskeratosis Congenita, X-linked Gene:DKC1. Exons: NM_001363.3:1-15. Variants(7): c.106T>G, c.115A>G, c.91C>G, c.146C>T, c.113T>C, c.214_215delCTinsTA, c.196A>G

Dystonia 16

Condition Gene/Varient
Dystonia 16 Gene:PRKRA. Exons: NM_003690.4:2-8. Variants(2): c.267_268delTA, c.665C>T

Early Infantile Epileptic Encephalopathy 3

Condition Gene/Varient
Early Infantile Epileptic Encephalopathy 3 Gene:SLC25A22. Exons: NM_024698.5:2-10. Variants(2): c.706G>T, c.617C>T

EEM Syndrome(Ectodermal Dysplasia, Ectrodactyly, and Macular Dystrophy)

Condition Gene/Varient
EEM Syndrome(Ectodermal Dysplasia, Ectrodactyly, and Macular Dystrophy) Gene:CDH3. Exons: NM_001793.4:1-16. Variants(3): c.965A>T, c.1508G>A, c.830delG

Ehlers-Danlos Syndrome Type VI

Condition Gene/Varient
Ehlers-Danlos Syndrome Type VI Gene:PLOD1. Exons: NM_000302.3:1-19. Variants(5): c.2032G>A, c.955C>T, c.1533C>G, c.1836G>C, c.2008C>T

Ehlers-Danlos Syndrome Type VIIC

Condition Gene/Varient
Ehlers-Danlos Syndrome Type VIIC Gene:ADAMTS2. Exons: NM_014244.4:2-22. Variants(2): c.2384G>A, c.673C>T

Ehlers-Danlos syndrome, cardiac valvular form

Condition Gene/Varient
Ehlers-Danlos syndrome, cardiac valvular form Gene:COL1A2. Exons: NM_000089.3:1,3-52. Variants(5): c.1404+1G>A, c.1404+1G>C, c.293_294insC, c.3601G>T, c.540+5G>A

Enhanced S-cone Syndrome

Condition Gene/Varient
Enhanced S-cone Syndrome Gene:NR2E3. Exons: NM_014249.2:1-8. Variants(4): c.119-2A>C, c.932G>A, c.226C>T, c.227G>A

Epidermolysis Bullosa Pruriginosa

Condition Gene/Varient
Epidermolysis Bullosa Pruriginosa Gene:COL7A1. Exons: NM_000094.3:1-118. Variants(18): c.2471_2472insG, c.7411C>T, c.4119+1G>T, c.7787delG, c.8479C>T, c.6091G>A, c.4039G>C, c.425A>G, c.427-2A>G, c.3861delG, c.8245G>A, c.5532+1G>A, c.6187C>T, c.933C>A, c.5821-1G>A, c.4888C>T, c.6205C>T, c.5819delC

Epidermolysis Bullosa Simplex with Pyloric Atresia

Condition Gene/Varient
Epidermolysis Bullosa Simplex with Pyloric Atresia Gene:PLEC. Exons: NM_000445.3:2-31,33. Variants(4): c.6955C>T, c.913C>T, c.12043_12044insG, c.9085C>T

Ethylmalonic Encephalopathy

Condition Gene/Varient
Ethylmalonic Encephalopathy Gene:ETHE1. Exons: NM_014297.3:2-7. Variants(5): c.604dupG, c.487C>T, c.221dupA, c.440_450delACAGCATGGCC, c.554T>G

Factor V Deficiency

Condition Gene/Varient
Factor V Deficiency Gene:F5. Exons: NM_000130.4:1-25. Variants(5): c.1160T>C, c.5189A>G, c.2401C>T, c.6304C>T, c.439G>T

Familial Dysautonomia

Condition Gene/Varient
Familial Dysautonomia Gene:IKBKAP. Exons: NM_003640.3:2-37. Variants(3): c.2087G>C, c.2741C>T, c.2204+6T>C

Familial Exudative Vitreoretinopathy 4

Condition Gene/Varient
Familial Exudative Vitreoretinopathy 4 Gene:LRP5. Exons: NM_002335.2:2-23. Variants(5): c.804_813delGGGGAAGAGG, c.2254C>G, c.4099G>A, c.1709G>A, c.1828G>A

Familial Mediterranean Fever

Condition Gene/Varient
Familial Mediterranean Fever Gene:MEFV. Exons: NM_000243.2:1-10. Variants(11): c.2040G>A, c.1437C>G, c.2040G>C, c.1958G>A, c.2082G>A, c.2080A>G, c.2177T>C, c.800C>T, c.2282G>A, c.2230G>T, c.2076_2078delAAT

Fanconi anemia, complementation group A

Condition Gene/Varient
Fanconi anemia, complementation group A Gene:FANCA. Exons: NM_000135.2:2-43. Variants(5): c.2574C>G, c.1115_1118delTTGG, c.233_236delTTGA, c.4130C>G, c.3788_3790delTCT

Fanconi anemia, complementation group C

Condition Gene/Varient
Fanconi anemia, complementation group C Gene:FANCC. Exons: NM_000136.2:2-15. Variants(6): c.1487T>G, c.1642C>T, c.67delG, c.553C>T, c.37C>T, c.456+4A>T

Fanconi anemia, complementation group D1

Condition Gene/Varient
Fanconi anemia, complementation group D1 Gene:BRCA2. Exons: NM_000059.3:2-27. Variants(8): c.8488-1G>A, c.9900dupA, c.4648G>T, c.7691_7692insAT, c.658_659delGT, c.631+1G>A, c.5837_5838delCAinsAG, c.631+2T>G

Fanconi anemia, complementation group E

Condition Gene/Varient
Fanconi anemia, complementation group E Gene:FANCE. Exons: NM_021922.2:2-10. Variants(3): c.1114-8G>A, c.355C>T, c.421C>T

Fanconi anemia, complementation group G

Condition Gene/Varient
Fanconi anemia, complementation group G Gene:FANCG. Exons: NM_004629.1:1-14. Variants(8): c.1066C>T, c.307+1G>C, c.1795_1804delTGGATCCGTC, c.637_643delTACCGCC, c.1480+1G>C, c.1183_1192delGAGGTGTTTT, c.925-2A>G, c.313G>T

Fanconi anemia, complementation group I

Condition Gene/Varient
Fanconi anemia, complementation group I Gene:FANCI. Exons: NM_001113378.1:2-38. Variants(2): c.3853C>T, c.3854G>A

Fanconi anemia, complementation group J

Condition Gene/Varient
Fanconi anemia, complementation group J Gene:BRIP1. Exons: NM_032043.2:2-20. Variants(2): c.1045G>C, c.2392C>T

Fanconi anemia, complementation group L

Condition Gene/Varient
Fanconi anemia, complementation group L Gene:FANCL. Exons: NM_018062.3:1-14. Variants(2): c.1096_1099dupATTA, c.1007_1009delTAT

Fanconi anemia, complementation group M

Condition Gene/Varient
Fanconi anemia, complementation group M Gene:FANCM. Exons: NM_020937.2:1-23. Variants(1): c.2171C>A

Fanconi anemia, complementation group N

Condition Gene/Varient
Fanconi anemia, complementation group N Gene:PALB2. Exons: NM_024675.3:1-13. Variants(4): c.1653T>A, c.3116delA, c.2962C>T, c.3549C>G

Fanconi anemia, complementation group O

Condition Gene/Varient
Fanconi anemia, complementation group O Gene:RAD51C. Exons: NM_058216.1:1-9. Variants(1): c.773G>A

Fanconi anemia, complementation group P

Condition Gene/Varient
Fanconi anemia, complementation group P Gene:SLX4. Exons: NM_032444.2:2-15. Variants(5): c.286delA, c.1093delC, c.514delC, c.1163+3_1163+4insT, c.1163+2T>A

FGA-Related Congenital Afibrinogenemia

Condition Gene/Varient
FGA-Related Congenital Afibrinogenemia Gene:FGA. Exons: NM_021871.2:1-5. Variants(3): c.1359dupC, c.1039C>T, c.510+1G>T

FGB-Related Congenital Afibrinogenemia

Condition Gene/Varient
FGB-Related Congenital Afibrinogenemia Gene:FGB. Exons: NM_005141.4:1-8. Variants(3): c.1148T>G, c.1289G>A, c.794C>T

Fibrochondrogenesis

Condition Gene/Varient
Fibrochondrogenesis Gene:COL11A1. Exons: NM_001854.3:1-67. Variants(2): c.2350G>C, c.1750dupG

Focal Segmental Glomerulosclerosis 3

Condition Gene/Varient
Focal Segmental Glomerulosclerosis 3 Gene:CD2AP. Exons: NM_012120.2:1-18. Variants(2): c.730-1delGinsCT, c.1834C>T

FRAS1-Related Fraser Syndrome

Condition Gene/Varient
FRAS1-Related Fraser Syndrome Gene:FRAS1. Exons: NM_025074.6:1-74. Variants(7): c.8602C>T, c.6991_6992insGG, c.5605_5606insT, c.4271C>G, c.9013C>T, c.7682+1G>T, c.3799C>T

FREM2-Related Fraser Syndrome

Condition Gene/Varient
FREM2-Related Fraser Syndrome Gene:FREM2. Exons: NM_207361.4:1-24. Variants(2): c.5914G>A, c.7519+1G>A

Friedreich Ataxia

Condition Gene/Varient
Friedreich Ataxia Gene:FXN. Exons: NM_000144.4:2-5. Variants(5): c.317T>G, c.517T>G, c.460A>T, c.389G>T, c.385-2A>G

Frontometaphyseal Dysplasia

Condition Gene/Varient
Frontometaphyseal Dysplasia Gene:FLNA. Exons: NM_001456.3:2-47. Variants(2): c.3557C>T, c.3476A>C

Fucosidosis

Condition Gene/Varient
Fucosidosis Gene FUCA1. Exons: NM_000147.4:1-8. Variants(6): c.1229T>G, c.244C>T, c.1160G>A, c.1138G>T, c.1279C>T, c.648C>A:

Fuhrmann Dyndrome

Condition Gene/Varient
Fuhrmann Dyndrome Gene:WNT7A. Exons: NM_004625.3:1-4. Variants(1): c.325G>A

Fumarate Hydratase Deficiency

Condition Gene/Varient
Fumarate Hydratase Deficiency Gene:FH. Exons: NM_000143.3:1-10. Variants(2): c.1127A>C, c.521C>G

Galactosemia

Condition Gene/Varient
Galactosemia Gene:GALT. Exons: NM_000155.3:1-11. Variants(85): c.512T>C, c.563A>G, c.957C>G, c.1048A>G, c.1030C>T, c.337G>A, c.404C>T, c.221T>C, c.997C>G, c.379A>G, c.855G>T, c.938G>A, c.667C>A, c.1138T>C, c.595G>A, c.505C>A, c.610C>T, c.980T>C, c.692G>A, c.920C>A, c.425T>A, c.462G>A, c.677T>C, c.844C>G, c.428C>T, c.989C>T, c.1001A>G, c.160C>T, c.404C>G, c.1014C>G, c.290A>G, c.507+2T>C, c.580T>C, c.424A>G, c.619C>T, c.974C>T, c.238C>T, c.626A>G, c.199C>T, c.611G>C, c.377+1G>A, c.382G>A, c.1098C>A, c.691C>T, c.949delC, c.998G>A, c.948G>A, c.815G>A, c.899G>A, c.253-2A>G, c.776G>A, c.536G>A, c.1140A>C, c.524G>A, c.881T>A, c.452T>C, c.747G>A, c.602G>A, c.775C>T, c.855G>C, c.200G>A, c.82+2T>A, c.329- 2A>C, c.18delC, c.564+1G>A, c.130G>A, c.616C>T, c.821-2A>G, c.634C>T, c.490delC, c.967T>C, c.413C>T, c.824delT, c.1075A>T, c.626A>C, c.687G>T, c.947G>A, c.341A>C, c.25C>T, c.443G>A, c.958G>A, c.607G>A, c.122G>A, c.1030C>A, c.584T>C

Gaucher Disease, Atypical

Condition Gene/Varient
Gaucher Disease, Atypical Gene:PSAP. Exons: NM_002778.2:1-14. Variants(4): c.1288C>T, c.1145G>T, c.1144T>G, c.1046T>C

Gaucher Disease

Condition Gene/Varient
Gaucher Disease Gene:GBA. Exons: NM_001005741.2:.. Variants(4): c.1226A>G, c.115+1G>A, c.84dupG, c.1448T>C

Generalized arterial calcification of infancy 1

Condition Gene/Varient
Generalized arterial calcification of infancy 1 Gene:ENPP1. Exons: NM_006208.2:2-25. Variants(6): c.1112A>T, c.913C>A, c.783C>G, c.1612G>C, c.2677G>T, c.1025G>T

Giant Axonal Neuropathy

Condition Gene/Varient
Giant Axonal Neuropathy Gene:GAN. Exons: NM_022041.3:2-11. Variants(7): c.505G>A, c.1268T>C, c.1456G>A, c.413G>A, c.1447C>T, c.1429C>T, c.601C>T

GLDC-Related Glycine Encephalopathy

Condition Gene/Varient
GLDC-Related Glycine Encephalopathy Gene:GLDC. Exons: NM_000170.2:2-25. Variants(4): c.1705G>A, c.1691G>T, c.2216G>A, c.1166C>T

Glomerulosclerosis, Focal segmental,1

Condition Gene/Varient
Glomerulosclerosis, Focal segmental,1 Gene:ACTN4. Exons: NM_004924.4:2-21. Variants(3): c.776C>T, c.763A>G, c.784T>C

Glutaric Acidemia I

Condition Gene/Varient
Glutaric Acidemia I Gene:GCDH. Exons: NM_000159.2:2-12. Variants(7): c.680G>C, c.1198G>A, c.1204C>T, c.1093G>A, c.1262C>T, c.883T>C, c.877G>A

Glutaric Acidemia IIA

Condition Gene/Varient
Glutaric Acidemia IIA Gene:ETFA. Exons: NM_000126.3:1-12. Variants(3): c.470T>G, c.797C>T, c.346G>

A Glutaric Acidemia IIB

Condition Gene/Varient
A Glutaric Acidemia IIB Gene:ETFB. Exons: NM_001985.2:1-6. Variants(2): c.491G>A, c.382G>A

Glutaric Acidemia IIC

Condition Gene/Varient
Glutaric Acidemia IIC Gene:ETFDH. Exons: NM_004453.2:1-13. Variants(7): c.1448C>T, c.250G>A, c.380T>A, c.524G>A, c.1130T>C, c.524G>T, c.2T>C

Glutathione Synthetase Deficiency

Condition Gene/Varient
Glutathione Synthetase Deficiency Gene:GSS. Exons: NM_000178.2:2-13. Variants(6): c.4delG, c.847C>T, c.799C>T, c.656A>G, c.491G>A, c.656A>C

Glycogen Storage Disease Type Ia

Condition Gene/Varient
Glycogen Storage Disease Type Ia Gene:G6PC. Exons: NM_000151.3:1-5. Variants(12): c.1039C>T, c.247C>T, c.370G>A, c.229T>C, c.551G>A, c.248G>A, c.883C>T, c.328G>A, c.380_381insTA, c.562G>C, c.497T>G, c.113A>T

Glycogen Storage Disease Type Ib/Ic

Condition Gene/Varient
Glycogen Storage Disease Type Ib/Ic Gene:SLC37A4. Exons: NM_001164278.1:3-11. Variants(9): c.1108_1109delCT, c.1129G>T, c.83G>A, c.352T>C, c.1309C>T, c.1082G>A, c.706_708delGTG, c.287G>A, c.1081G>T

Glycogen Storage Disease Type II

Condition Gene/Varient
Glycogen Storage Disease Type II Gene:GAA. Exons: NM_000152.3:2-20. Variants(132): c.1843G>A, c.1636+5G>C, c.1856G>A, c.1798C>T, c.271delG, c.1115A>T, c.1796C>A, c.482_483delCC, c.896T>G, c.1333G>C, c.1826dupA, c.1703A>T, c.784G>A, c.1552- 3C>G, c.1935C>A, c.546G>T, c.923A>C, c.1222A>G, c.1064T>C, c.2741delAinsCAG, c.2269C>T, c.1548G>A, c.1210G>A, c.692+1G>C, c.2173C>T, c.1364A>T, c.670C>T, c.2281delGinsAT, c.1755-1G>A, c.1725C>A, c.935T>G, c.340_341insT, c.643G>T, c.2012T>G, c.2380delC, c.1585_1586delTCinsGT, c.1076-1G>C, c.794delG, c.710C>T, c.1687C>T, c.2846T>A, c.1978C>T, c.2331+4A>G, c.989G>A, c.1564C>G, c.623T>C, c.1082C>T, c.1933G>A, c.1802C>G, c.971C>T, c.1432G>A, c.1905C>A, c.1735G>A, c.307T>G, c.377G>A, c.1941C>G, c.1551+1G>C, c.2185delC, c.685_686insCGGC, c.1316T>A, c.1556T>C, c.875A>G, c.2174G>C, c.1377_1379delCGA, c.2014C>T, c.2040G>A, c.2608C>T, c.1561G>A, c.2646+2T>A, c.573C>A, c.2605delG, c.2560C>T, c.1979G>A, c.1724A>C, c.716delT, c.2140delC, c.925G>A, c.2815_2816delGT, c.1120T>C, c.172C>T, c.1696T>C, c.2331+2T>C, c.1076-22T>G, c.953T>C, c.872T>C, c.2041-2A>C, c.118C>T, c.2303C>G, c.2702T>A, c.1214T>C, c.1634C>T, c.1100G>A, c.877G>A, c.1799G>A, c.1327-2A>G, c.1655T>C, c.2432delT, c.1836C>G, c.1194+2T>A, c.1326+1G>A, c.2219_2220delTG, c.1927G>A, c.2132C>G, c.1375G>A, c.854C>G, c.988T>G, c.2015G>A, c.1827delC, c.1080C>G, c.1128_1129delGGinsC, c.1942G>A, c.1438-1G>C, c.2104C>T, c.2188G>T, c.18_25delGCCCTGCT, c.2662G>T, c.379_380delTG, c.1411_1414delGAGA, c.2024_2026delACA, c.2639C>A, c.525delT, c.722_723delTT, c.1857C>G, c.1555A>G, c.1441T>C, c.1309C>T, c.309C>A, c.1456G>C, c.399C>A, c.1124G>T, c.1437+2T>C, c.-32-3C>A

Glycogen Storage Disease Type III

Condition Gene/Varient
Glycogen Storage Disease Type III Gene:AGL. Exons: NM_000642.2:2-34. Variants(13): c.2039G>A, c.3682C>T, c.3980G>A, c.16C>T, c.4529dupA, c.4260-12A>G, c.1999delC, c.18_19delGA, c.2590C>T, c.1222C>T, c.3965delT, c.4456delT, c.4342G>C

Glycogen Storage Disease Type IV

Condition Gene/Varient
Glycogen Storage Disease Type IV Gene:GBE1. Exons: NM_000158.3:1-16. Variants(10): c.771T>A, c.1571G>A, c.986A>G, c.1883A>G, c.986A>C, c.1643G>A, c.1543C>T, c.1570C>T, c.671T>C, c.1774G>T

Glycogen Storage Disease Type IXc

Condition Gene/Varient
Glycogen Storage Disease Type IXc Gene:PHKG2. Exons: NM_000294.2:2-10. Variants(1): c.130C>T

Glycogen Storage Disease Type XI

Condition Gene/Varient
Glycogen Storage Disease Type XI Gene:LDHA. Exons: NM_005566.3:2-8. Variants(2): c.126+1G>A, c.640_641delCT

Glycogen Storage Disease Type XII

Condition Gene/Varient
Glycogen Storage Disease Type XII Gene:ALDOA. Exons: NM_000034.3:7-14. Variants(2): c.619G>A, c.386A>G

Glycogen Storage Disease Type XIII

Condition Gene/Varient
Glycogen Storage Disease Type XIII Gene:ENO3. Exons: NM_053013.3:2-12. Variants(2): c.467G>A, c.1121G>A

Glycogen Storage Disease Type XIV

Condition Gene/Varient
Glycogen Storage Disease Type XIV Gene:PGM1. Exons: NM_002633.2:1-11. Variants(2): c.1145-1G>C, c.343A>G

GM1-Gangliosidosis

Condition Gene/Varient
GM1-Gangliosidosis Gene:GLB1. Exons: NM_000404.2:1-16. Variants(14): c.622C>T, c.1772A>G, c.245C>T, c.145C>T, c.1445G>A, c.1369C>T, c.176G>A, c.601C>T, c.947A>G, c.152T>C, c.1370G>A, c.1771T>A, c.1051C>T, c.202C>T

GM2-Gangliosidosis, AB variant

Condition Gene/Varient
GM2-Gangliosidosis, AB variant Gene:GM2A. Exons: NM_000405.4:1-4. Variants(4): c.410delA, c.160G>T, c.412T>C, c.262_264delAAG

GNE-Related Myopathy

Condition Gene/Varient
GNE-Related Myopathy Gene:GNE. Exons: NM_005476.5:2-12. Variants(6): c.1727G>A, c.737G>A, c.1714G>T, c.2086G>A, c.2135T>C, c.909T>A

GRACILE Syndrome

Condition Gene/Varient
GRACILE Syndrome Gene:BCS1L. Exons: NM_004328.4:3-9. Variants(2): c.232A>G, c.166C>T

Greenberg dysplasia

Condition Gene/Varient
Greenberg dysplasia Gene:LBR. Exons: NM_002296.3:2-14. Variants(3): c.1748G>A, c.1402delT, c.32_35delTGGT

Griscelli Syndrome Type 1

Condition Gene/Varient
Griscelli Syndrome Type 1 Gene:MYO5A. Exons: NM_000259.3:2-41. Variants(1): c.2332C>T

Griscelli Syndrome Type 2

Condition Gene/Varient
Griscelli Syndrome Type 2 Gene:RAB27A. Exons: NM_004580.4:2-6. Variants(5): c.217T>G, c.352C>T, c.259G>C, c.389T>C, c.454G>C

Guanidinoaceteate Methyltransferase Deficiency

Condition Gene/Varient
Guanidinoaceteate Methyltransferase Deficiency Gene:GAMT. Exons: NM_000156.5:2-6. Variants(1): c.506G>A

Gyrate Atrophy Of the Choroid And Retina

Condition Gene/Varient
Gyrate Atrophy Of the Choroid And Retina Gene:OAT. Exons: NM_000274.3:2-10. Variants(25): c.1172G>A, c.952delG, c.824G>A, c.596C>A, c.159delC, c.627T>A, c.897C>G, c.1201G>T, c.278G>T, c.3G>A, c.1276C>T, c.268C>G, c.994G>A, c.952G>A, c.1180T>C, c.677C>T, c.955C>T, c.1205T>C, c.539G>C, c.1250C>T, c.1186C>T, c.901-2A>G, c.192_193delAG, c.533G>A, c.812G>A

HADHA related Trifunctional Protein Deficiency

Condition Gene/Varient
HADHA related Trifunctional Protein Deficiency Gene:HADHA. Exons: NM_000182.4:1-20. Variants(1): c.1793_1794delAT

HADHB related Trifunctional Protein Deficiency

Condition Gene/Varient
HADHB related Trifunctional Protein Deficiency Gene:HADHB. Exons: NM_000183.2:2-16. Variants(2): c.1331G>A, c.1364T>G

HARP Syndrome

Condition Gene/Varient
HARP Syndrome Gene:PANK2. Exons: NM_153638.2:1-7. Variants(2): c.1441C>T, c.1413-1G>T

Hemophilia A

Condition Gene/Varient
HARP Syndrome Gene:F8. Exons: NM_000132.3:1-26. Variants(508): c.1498delA, c.680G>A, c.4770T>A, c.541G>A, c.1009+1G>A, c.755_756delCA, c.6350T>G, c.5562G>A, c.1311delG, c.5219+1G>A, c.1520C>G, c.524A>G, c.5894G>T, c.5561G>A, c.3385delC, c.5904C>A, c.670+5G>A, c.242C>A, c.6967C>G, c.2048A>G, c.3619_3622delCACA, c.5981T>C, c.1538-2A>G, c.1420G>A, c.6743G>C, c.6115+4A>G, c.6464_6465delAA, c.2939delG, c.5665C>T, c.5452G>T, c.195C>A, c.1357G>T, c.1718G>A, c.1831C>T, c.6084delG, c.6325C>T, c.1325A>G, c.1026T>A, c.935T>C, c.1266_1270delTGACA, c.729delT, c.4483delG, c.6226G>T, c.1750delC, c.6193T>C, c.4339delG, c.5389C>T, c.6393G>A, c.1230_1232delGGA, c.6724-1G>A, c.658G>C, c.2384_2388delGAACA, c.144-2A>G, c.901C>T

Intron 22 inversion, Intron 1 inversion Hemophilia B

Condition Gene/Varient
Intron 22 inversion, Intron 1 inversion Hemophilia B Gene:F9. Exons: NM_000133.3:1-8. Variants(301): c.392-2A>G, c.60delA, c.1295G>A, c.1278delT, c.985delA, c.1342delT, c.1024delA, c.420A>T, c.272A>G, c.464G>A, c.520+2T>G, c.162G>C, c.545_546delCT, c.505T>C, c.281G>T, c.268C>T, c.774T>G, c.1256T>A, c.1067G>A, c.422G>A, c.407T>C, c.907delC, c.400T>C, c.174delG, c.80_83delAATG, c.1322A>G, c.229delG, c.782G>A, c.1173T>A, c.1097C>A, c.698C>A, c.280G>A, c.501G>T, c.735delT, c.572G>A, c.1136G>A, c.50T>A, c.260T>G, c.941A>G, c.416G>A, c.219A>C, c.914A>G, c.263G>A, c.284delA, c.179_180delTT, c.155T>C, c.237A>C, c.392-1G>T, c.534_535delTG, c.487dupC, c.679G>T, c.724-2A>G, c.990C>A, c.1031T>A, c.1187G>A, c.758G>A, c.344A>G, c.681_682insT, c.128G>A, c.317G>A, c.205T>C, c.781T>C, c.1070G>A, c.757G>A, c.1220G>A, c.138G>C, c.350G>A, c.862G>T, c.349T>A, c.412A>C, c.1361T>C, c.688G>A, c.881G>A, c.936C>A, c.127C>T, c.1064G>A, c.754T>C, c.603T>G, c.1142C>A, c.88G>A, c.1105C>G, c.1275A>C, c.214G>C, c.482A>G, c.236A>C, c.1068G>A, c.173G>A, c.1018G>T, c.305G>A, c.1235G>A, c.1301_1302delAG, c.278-3A>G, c.277G>A, c.687_689delTGG, c.1023C>A, c.278-12C>T, c.1304G>A, c.1025C>A, c.1146T>A, c.277+5G>C, c.427C>G, c.909delC, c.423C>A, c.478G>A, c.786T>G, c.547_548delGT, c.109G>A, c.1293G>A, c.967_974delGAACCCTT, c.682G>C, c.413A>G, c.775G>T, c.1144T>C, c.520+13A>G, c.83G>A, c.1088G>A, c.247_248insA, c.96delT, c.172G>A, c.1323T>G, c.722delA, c.917A>G, c.1213G>A, c.1343_1350delCCCGGTAT, c.838+2T>G, c.55delC, c.862delG, c.1188T>A, c.796G>A, c.1151G>C, c.892C>T, c.804T>G, c.454A>T, c.655C>T, c.1084A>G, c.1346G>A, c.1276A>C, c.471T>A, c.493G>T, c.1349A>G, c.291T>G, c.1325G>A, c.1274T>G, c.1109A>C, c.838+1G>C, c.533G>A, c.799delC, c.1357T>A, c.947T>C, c.157G>A, c.253-2A>G, c.676C>G, c.536G>A, c.827_828delCA, c.1219T>A, c.165_169delTGTTC, c.1181T>A, c.1185C>G, c.155delT, c.622G>T, c.212T>C, c.185_188delGAGA, c.874delC, c.223C>T, c.946A>T, c.1318A>G, c.689_691delGAG, c.905A>G, c.856_858delGAG, c.322delT, c.532T>C, c.723+2T>C, c.1328T>C, c.707G>A, c.199G>A, c.277+4A>G, c.800A>G, c.1217C>G, c.755G>A, c.1147C>A, c.799C>T, c.484C>A, c.373G>A, c.1241C>A, c.389delT, c.556delA, c.401G>A, c.324C>A, c.316G>A, c.89-6T>G, c.1231A>G, c.509G>A, c.370G>A, c.88+5G>A, c.145T>C, c.1151_1154delGATC, c.1150C>T, c.922delG, c.1244A>G, c.835G>A, c.813delT, c.1145G>A, c.1132G>T, c.1240C>A, c.83delG, c.723G>C, c.1058T>C, c.224G>A, c.1306G>A, c.479G>A, c.127delC, c.1294G>A, c.278A>G, c.1135C>G, c.1174A>G, c.252+5G>A, c.415G>A, c.1175delA, c.413delA, c.1129G>T, c.352T>A, c.226G>A, c.279T>A, c.1113C>A, c.59T>A, c.1183T>C, c.418dupA, c.568_569delAC, c.133_134insT, c.720G>A, c.808G>T, c.466T>C, c.942T>G, c.197A>T, c.219_220insA, c.253-3T>G, c.723+1G>T, c.1169T>C, c.252+1G>A, c.1069G>A, c.292G>T, c.957_958delGGinsC, c.1139C>A, c.1270T>C, c.677G>A, c.724-1G>A, c.1077_1078delCT, c.161_162delAG, c.932delA, c.761G>A, c.1348T>C, c.659delC, c.1324G>A, c.391+1G>C, c.719G>A, c.520+1G>T, c.1066T>A, c.1258G>T, c.783G>T, c.1297G>A, c.235G>A, c.287A>C, c.88+5_88+8delGTTT, c.449delA, c.414T>A, c.356G>A, c.470G>A, c.206G>A, c.82T>C, c.871G>A, c.328G>A, c.944A>G, c.1358G>A, c.148G>A, c.1189G>C, c.1168A>T, c.191G>A, c.278-1G>A, c.163T>A, c.392delA, c.668delA, c.278-2A>T, c.184A>T, c.286C>T, c.1052G>A, c.785T>C, c.659C>A, c.353G>A, c.1138G>A, c.190T>C, c.1074_1075delAG, c.1182G>A, c.434G>A, c.956T>C, c.453_454delCA, c.277+2T>C, c.508T>C, c.30delA, c.1183T>A, c.255_256delTG, c.391+2T>C

Hereditary Fructose Intolerance

Condition Gene/Varient
Hereditary Fructose Intolerance Gene:ALDOB. Exons: NM_000035.3:2-9. Variants(7): c.10C>T, c.1005C>G, c.720C>A, c.178C>T, c.524C>A, c.360_363delCAAA, c.448G>C

Hereditary Motor and Sensory Neuropathy with Agenesis of the Corpus Callosum

Condition Gene/Varient
Hereditary Motor and Sensory Neuropathy with Agenesis of the Corpus Callosum Gene:SLC12A6. Exons: NM_133647.1:1- 25. Variants(5): c.619C>T, c.2436+1delG, c.3031C>T, c.1584_1585delCTinsG, c.2023C>T

Hereditary Sensory and Autonomic Neuropathy IV

Condition Gene/Varient
Hereditary Sensory and Autonomic Neuropathy IV Gene:NTRK1. Exons: NM_001012331.1:2-16. Variants(9): c.1076A>G, c.1711G>C, c.1741A>G, c.2066C>T, c.851-33T>A, c.1908_1909insT, c.1709delT, c.1834G>T, c.2321G>C

Hermansky-Pudlak Syndrome 1

Condition Gene/Varient
Hermansky-Pudlak Syndrome 1 Gene:HPS1. Exons: NM_000195.3:3-20. Variants(6): c.1472_1487dupCCAGCAGGGGAGGCCC, c.397G>T, c.972delC, c.398+5G>A, c.972_973insC, c.1996G>T

Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency

Condition Gene/Varient
Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency Gene:CBS. Exons: NM_000071.2:3-17. Variants(12): c.1330G>A, c.341C>T, c.430G>A, c.434C>T, c.502G>A, c.572C>T, c.1058C>T, c.797G>A, c.919G>A, c.1397C>T, c.1150A>G, c.1265C>T

Hydrolethalus Syndrome 1

Condition Gene/Varient
Hydrolethalus Syndrome 1 Gene:HYLS1. Exons: NM_145014.2:4. Variants(1): c.632A>G

Hydrolethalus Syndrome 2

Condition Gene/Varient
Hydrolethalus Syndrome 2 Gene:KIF7. Exons: NM_198525.2:2-4,6-19. Variants(1): c.2896_2897delGC

Hyper-IgD syndrome

Condition Gene/Varient
Hyper-IgD syndrome Gene:MVK. Exons: NM_000431.2:2-11. Variants(5): c.803T>C, c.829C>T, c.1129G>A, c.59A>C, c.494C>T

Hypermethioninemia

Condition Gene/Varient
Hypermethioninemia Gene:MAT1A. Exons: NM_000429.2:1-9. Variants(9): c.1006G>A, c.164C>A, c.966T>G, c.790C>T, c.914T>C, c.1043_1044delTG, c.538_539insTG, c.1070C>T, c.827_828insG

Hyperornithinemia-Hyperammonemia-Homocitrullinuria Syndrome

Condition Gene/Varient
Hyperornithinemia-Hyperammonemia-Homocitrullinuria Syndrome Gene:SLC25A15. Exons: NM_014252.3:2-7. Variants(11): c.658G>A, c.562_564delTTC, c.824G>A, c.79G>A, c.815C>T, c.212T>A, c.535C>T, c.110T>G, c.95C>G, c.538G>A, c.569G>A

Hyperprolinemia Type II

Condition Gene/Varient
Hyperprolinemia Type II Gene:ALDH4A1. Exons: NM_003748.3:2-15. Variants(1): c.1055C>T

Hypomagnesemia 5

Condition Gene/Varient
Hypomagnesemia 5 Gene:CLDN19. Exons: NM_148960.2:1-5. Variants(3): c.169C>G, c.59G>A, c.269T>C

Hypomyelination and Congenital Cataract

Condition Gene/Varient
Hypomyelination and Congenital Cataract Gene:FAM126A. Exons: NM_032581.3:2-11. Variants(1): c.158T>C

Hypoparathyroidism-Retardation-Dysmorphism Syndrome

Condition Gene/Varient
Hypoparathyroidism-Retardation-Dysmorphism Syndrome Gene:TBCE. Exons: NM_003193.3:2-17. Variants(2): c.1113T>A, c.66_67delAG

Hypophosphatasia

Condition Gene/Varient
Hypophosphatasia Gene:ALPL. Exons: NM_000478.4:2-12. Variants(20): c.979T>C, c.746G>T, c.211C>T, c.881A>C, c.535G>A, c.1366G>A, c.620A>C, c.571G>A, c.1559delT, c.1133A>T, c.98C>T, c.814C>T, c.346G>A, c.892G>A, c.1306T>C, c.1250A>G, c.1001G>A, c.526G>A, c.407G>A, c.212G>C

Hypotrichosis, congenital, with juvenile macular dystrophy

Condition Gene/Varient
Hypotrichosis, congenital, with juvenile macular dystrophy Gene:CDH3. Exons: NM_001793.4:1-16. Variants(1): c.981delG

Ichthyosis Follicularis-Atrichia-Photophobia Syndrome

Condition Gene/Varient
Ichthyosis Follicularis-Atrichia-Photophobia Syndrome Gene:MBTPS2. Exons: NM_015884.3:1-11. Variants(4): c.1286G>A, c.677G>T, c.1424T>C, c.261G>A IGF1

Deficiency

Condition Gene/Varient
Deficiency Gene:IGF1. Exons: NM_000618.3:1-4. Variants(1): c.274G>A

Infantile Sialic acid Storage Disorder

Condition Gene/Varient
Infantile Sialic acid Storage Disorder Gene:SLC17A5. Exons: NM_012434.4:1-11. Variants(3): c.1001C>G, c.548A>G, c.918T>G

Infantile Striatonigral Degeneration

Condition Gene/Varient
Infantile Striatonigral Degeneration Gene:NUP62. Exons: NM_153719.3:3. Variants(1): c.1172A>C

Infantile-Onset Spinocerebellar Ataxia

Condition Gene/Varient
Infantile Striatonigral Degeneration Gene:C10orf2. Exons: NM_021830.4:1-5. Variants(5): c.955A>G, c.1370C>T, c.1287C>T, c.952G>A, c.1523A>G

Isolated Growth Hormone Deficiency

Condition Gene/Varient
Isolated Growth Hormone Deficiency Gene:BTK. Exons: NM_000061.2:2-19. Variants(2): c.1625T>C, c.1125T>G

Isolated Microphthalmia 3

Condition Gene/Varient
Isolated Microphthalmia 3 Gene:RAX. Exons: NM_013435.2:1-2. Variants(3): c.575G>A, c.439C>T, c.909C>G

Isolated Microphthalmia 5

Condition Gene/Varient
Isovaleric Acidemia Gene:IVD. Exons: NM_002225.3:1-12. Variants(5): c.941C>T, c.1188delT, c.157C>T, c.605G>T, c.134T>C

ITGA6-Related Epidermolysis Bullosa with Pyloric Atresia

Condition Gene/Varient
ITGA6-Related Epidermolysis Bullosa with Pyloric Atresia Gene:ITGA6. Exons: NM_000210.2:1-25. Variants(1): c.791delC

ITGB4-Related Epidermolysis Bullosa with Pyloric Atresia

Condition Gene/Varient
ITGB4-Related Epidermolysis Bullosa with Pyloric Atresia Gene:ITGB4. Exons: NM_001005731.1:2-39. Variants(14): c.112T>C, c.1684T>C, c.3841C>T, c.4410delG, c.4433G>A, c.467T>C, c.3977-19T>A, c.3674G>A, c.3801_3802insT, c.1150delG, c.3793+1G>A, c.1660C>T, c.182G>A, c.2792G>A

Johanson-Blizzard Syndrome

Condition Gene/Varient
Johanson-Blizzard Syndrome Gene:UBR1. Exons: NM_174916.2:1-47. Variants(2): c.407A>G, c.1537C>T

Joubert Syndrome 1

Condition Gene/Varient
Joubert Syndrome 1 Gene:INPP5E. Exons: NM_019892.4:1-10. Variants(4): c.1132C>T, c.1543C>T, c.1688G>A, c.1304G>A

Joubert Syndrome 10

Condition Gene/Varient
Joubert Syndrome 10 Gene:OFD1. Exons: NM_003611.2:1-23. Variants(2): c.2767delG, c.2844_2850delAGACAAA

Joubert syndrome 13

Condition Gene/Varient
Joubert syndrome 13 Gene:TCTN1. Exons: NM_001082538.2:1-14. Variants(1): c.221-2A>

G Joubert Syndrome 2

Condition Gene/Varient
G Joubert Syndrome 2 Gene:TMEM216. Exons: NM_001173990.2:1-5. Variants(2): c.218G>A, c.218G>T

Joubert Syndrome 3

Condition Gene/Varient
Joubert Syndrome 3 Gene:AHI1. Exons: NM_017651.4:3-28. Variants(10): c.1328T>A, c.1303C>T, c.985C>T, c.2168G>A, c.1052G>T, c.1765C>T, c.1484G>A, c.3263_3264delGG, c.1051C>T, c.2370dupT

Joubert Syndrome 5

Condition Gene/Varient
Joubert Syndrome 5 Gene:CEP290. Exons: NM_025114.3:2-54. Variants(5): c.21G>T, c.5668G>T, c.2249T>G, c.4723A>T, c.4656delA

Joubert Syndrome 6

Condition Gene/Varient
Joubert Syndrome 6 Gene:TMEM67. Exons: NM_153704.5:1-28. Variants(3): c.755T>C, c.130C>T, c.1538A>G

Joubert Syndrome 7

Condition Gene/Varient
Joubert Syndrome 7 Gene:RPGRIP1L. Exons: NM_015272.2:2-22,24-27. Variants(7): c.1975T>C, c.697A>T, c.1843A>C, c.2269delA, c.2413C>T, c.757C>T, c.2050C>T

Joubert Syndrome 8

Condition Gene/Varient
Joubert Syndrome 8 Gene:ARL13B. Exons: NM_182896.2:1-10. Variants(3): c.236G>A, c.598C>T, c.246G>A

Joubert Syndrome 9

Condition Gene/Varient
Joubert Syndrome 9 Gene:CC2D2A. Exons: NM_001080522.2:3-38. Variants(5): c.4582C>T, c.3289delG, c.4667A>T, c.3364C>T, c.2848C>T

Kanzaki Disease

Condition Gene/Varient
Kanzaki Disease Gene:NAGA. Exons: NM_000262.2:1-9. Variants(3): c.985C>T, c.577G>T, c.986G>A

KCNJ11-Related Congenital Hyperinsulinism

Condition Gene/Varient
KCNJ11-Related Congenital Hyperinsulinism Gene:KCNJ11. Exons: NM_000525.3:1. Variants(4): c.761C>T, c.440T>C, c.776A>G, c.36C>A

Kelley-Seegmiller Syndrome

Condition Gene/Varient
Kelley-Seegmiller Syndrome Gene:HPRT1. Exons: NM_000194.2:2-9. Variants(4): c.193C>T, c.602A>G, c.239A>T, c.329C>T

Knobloch syndrome

Condition Gene/Varient
Knobloch syndrome Gene:COL18A1. Exons: NM_030582.3:1-41. Variants(2): c.3517_3518delCC, c.3618_3619delGG

Krabbe Disease

Condition Gene/Varient
Krabbe Disease Gene:GALC. Exons: NM_000153.3:2-17. Variants(5): c.1153G>T, c.1586C>T, c.1630G>A, c.857G>A, c.1796T>G

L1 Syndrome

Condition Gene/Varient
L1 Syndrome Gene:L1CAM. Exons: NM_000425.3:1-28. Variants(14): c.536T>G, c.924C>T, c.1792G>A, c.1354G>A, c.719C>T, c.3489_3490delTG, c.2432-19A>C, c.2254G>A, c.551G>A, c.791G>A, c.3581C>T, c.1108G>A, c.1939+5G>A, c.3458-1G>C LAMA2-Related Congenital Muscular Dystrophy. Gene:LAMA2. Exons: NM_000426.3:1-65. Variants(10): c.2098_2099delTT, c.8314delA, c.2901C>A, c.825delC, c.3718C>T, c.7732C>T, c.2049_2050delAG, c.7147C>T, c.9253C>T, c.4645C>T

LAMA3-Related Junctional Epidermolysis Bullosa

Condition Gene/Varient
LAMA3-Related Junctional Epidermolysis Bullosa Gene:LAMA3. Exons: NM_000227.3:1-38. Variants(4): c.2116A>T, c.335delG, c.4135C>T, c.1981C>T

LAMB3-Related Junctional Epidermolysis Bullosa

Condition Gene/Varient
LAMB3-Related Junctional Epidermolysis Bullosa Gene:LAMB3. Exons: NM_000228.2:2-23. Variants(10): c.1587_1588delAG, c.496C>T, c.727C>T, c.2806C>T, c.904delT, c.1903C>T, c.1830G>A, c.1438_1442delCCGTG, c.628G>A, c.124C>T

LAMC2-Related Junctional Epidermolysis Bullosa

Condition Gene/Varient
LAMC2-Related Junctional Epidermolysis Bullosa Gene:LAMC2. Exons: NM_005562.2:1-23. Variants(8): c.1065C>G, c.1659C>A, c.3512_3513insA, c.2137_2143delCAGAACC, c.405-1G>A, c.1067-1G>A, c.283C>T, c.733C>T

Lathosterolosis

Condition Gene/Varient
Lathosterolosis Gene:SC5DL. Exons: NM_006918.4:2-5. Variants(1): c.86G>A

Leber Congenital Amaurosis 1

Condition Gene/Varient
Leber Congenital Amaurosis 1 Gene:GUCY2D. Exons: NM_000180.3:3-19. Variants(3): c.1694T>C, c.2945delG, c.622delC

Leber congenital amaurosis 10

Condition Gene/Varient
Leber congenital amaurosis 10 Gene:CEP290. Exons: NM_025114.3:2-54. Variants(1): c.3185delT

Leber Congenital Amaurosis 13

Condition Gene/Varient
Leber Congenital Amaurosis 13 Gene:RDH12. Exons: NM_152443.2:3-9. Variants(13): c.379G>T, c.377C>T, c.295C>A, c.451C>G, c.152T>A, c.523T>C, c.184C>T, c.146C>T, c.806_810delCCCTG, c.464C>T, c.565C>T, c.677A>G, c.451C>A

Leber Congenital Amaurosis 14

Condition Gene/Varient
Leber Congenital Amaurosis 14 Gene:LRAT. Exons: NM_004744.3:2-3. Variants(2): c.525T>A, c.217_218delAT

Leber Congenital Amaurosis 15

Condition Gene/Varient
Leber Congenital Amaurosis 15 Gene:TULP1. Exons: NM_003322.3:1-15. Variants(2): c.1204G>T, c.1198C>T

Leber Congenital Amaurosis 16

Condition Gene/Varient
Leber Congenital Amaurosis 16 Gene:KCNJ13. Exons: NM_002242.4:2-3. Variants(2): c.496C>T, c.722T>C

Leber Congenital Amaurosis 2

Condition Gene/Varient
Leber Congenital Amaurosis 2 Gene:RPE65. Exons: NM_000329.2:1-14. Variants(4): c.700C>T, c.907A>T, c.1067delA, c.1292A>G

Leber Congenital Amaurosis 4

Condition Gene/Varient
Leber Congenital Amaurosis 4 Gene:AIPL1. Exons: NM_014336.3:1-6. Variants(5): c.244C>T, c.715T>C, c.905G>T, c.589G>C, c.834G>A

Leber Congenital Amaurosis 7

Condition Gene/Varient
Leber Congenital Amaurosis 7 Gene:CRX. Exons: NM_000554.4:2-4. Variants(2): c.268C>T, c.529delG

Leber Congenital Amaurosis 8

Condition Gene/Varient
Leber Congenital Amaurosis 8 Gene:CRB1. Exons: NM_201253.2:1-12. Variants(4): c.2688T>A, c.2843G>A, c.3299T>G, c.3997G>T

Leber Congenital Amaurosis 9

Condition Gene/Varient
Leber Congenital Amaurosis 9 Gene:NMNAT1. Exons: NM_022787.3:2-5. Variants(9): c.769G>A, c.457C>G, c.817A>G, c.25G>A, c.619C>T, c.710G>T, c.451G>T, c.507G>A, c.838T>C

Leigh Syndrome, French-Canadian Type

Condition Gene/Varient
Leigh Syndrome, French-Canadian Type Gene:LRPPRC. Exons: NM_133259.3:2-38. Variants(2): c.1061C>T, c.3830_3839delGTGGTGCAATinsAG

Lesch-Nyhan Syndrome

Condition Gene/Varient
Lesch-Nyhan Syndrome Gene:HPRT1. Exons: NM_000194.2:2-9. Variants(4): c.508C>T, c.170T>C, c.143G>A, c.212_213insG

Lethal Acantholytic Epidermolysis Bullosa

Condition Gene/Varient
Lethal Acantholytic Epidermolysis Bullosa Gene:DSP. Exons: NM_004415.2:1-24. Variants(2): c.6370_6371delCT, c.5800C>T

Lethal Congenital Contracture Syndrome 1

Condition Gene/Varient
Lethal Congenital Contracture Syndrome 1 Gene:GLE1. Exons: NM_001003722.1:1-16. Variants(2): c.1849G>A, c.2051T>C

LIG4 Syndrome

Condition Gene/Varient
LIG4 Syndrome Gene:LIG4. Exons: NM_002312.3:2. Variants(4): c.1738C>T, c.1406G>A, c.2440C>T, c.833G>A

Limb-Girdle Muscular Dystrophy Type 2A

Condition Gene/Varient
Limb-Girdle Muscular Dystrophy Type 2A Gene:CAPN3. Exons: NM_000070.2:1-24. Variants(9): c.956C>T, c.1469G>A, c.1795_1796insA, c.257C>T, c.2362_2363delAGinsTCATCT, c.328C>T, c.1715G>A, c.550delA, c.2306G>A

Limb-Girdle Muscular Dystrophy type 2B

Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2B Gene:DYSF. Exons: NM_003494.3:1-35,37-55. Variants(5): c.2372C>G, c.5201A>G, c.895G>A, c.200_201delTGinsAT, c.1873G>T

Limb-Girdle Muscular Dystrophy type 2C

Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2C Gene:SGCG. Exons: NM_000231.2:2-8. Variants(2): c.787G>A, c.848G>A

Limb-Girdle Muscular Dystrophy type 2D

Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2D Gene:SGCA. Exons: NM_000023.2:1-9. Variants(4): c.293G>A, c.574C>T, c.739G>A, c.229C>T

Limb-Girdle Muscular Dystrophy type 2E

Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2E Gene:SGCB. Exons: NM_000232.4:2-6. Variants(7): c.272G>T, c.452C>G, c.299T>A, c.323T>G, c.552T>G, c.341C>T, c.272G>C

Limb-Girdle Muscular Dystrophy type 2G

Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2G Gene:TCAP. Exons: NM_003673.3:1-2. Variants(1): c.157C>T

Limb-Girdle Muscular Dystrophy type 2H

Condition Gene/Varient
Limb-Girdle Muscular Dystrophy type 2H Gene:TRIM32. Exons: NM_012210.3:2. Variants(3): c.1560delC, c.1181G>A, c.1459G>A

Limb-Girdle Muscular Dystrophy Type 2L

Condition Gene/Varient
Limb-Girdle Muscular Dystrophy Type 2L Gene:ANO5. Exons: NM_213599.2:1-22. Variants(6): c.2311_2312delCA, c.1407+5G>A, c.191_192insA, c.1295C>G, c.2272C>T, c.692G>T

Lipoid Congenital Adrenal Hyperplasia

Condition Gene/Varient
Lipoid Congenital Adrenal Hyperplasia Gene:STAR. Exons: NM_000349.2:1-7. Variants(8): c.562C>T, c.650G>C, c.545G>A, c.772C>T, c.559G>A, c.577C>T, c.749G>A, c.545G>T

Lissencephaly with Cerebellar Hypoplasia

Condition Gene/Varient
Lissencephaly with Cerebellar Hypoplasia Gene:RELN. Exons: NM_005045.3:1-65. Variants(1): c.5615-1G>A Long-Chain

Hydroxyacyl-Coa Dehydrogenase Deficiency

Condition Gene/Varient
Hydroxyacyl-Coa Dehydrogenase Deficiency Gene:HADHA. Exons: NM_000182.4:1-20. Variants(4): c.2132_2133insC, c.1528G>C, c.1132C>T, c.1678C>T

Lujan-Fryns Syndrome

Condition Gene/Varient
Lujan-Fryns Syndrome Gene:MED12. Exons: NM_005120.2:1-41,43-45. Variants(1): c.3020A>

G Macular Corneal Dystrophy

Condition Gene/Varient
G Macular Corneal Dystrophy Gene:CHST6. Exons: NM_021615.4:3. Variants(2): c.609C>A, c.599T>G

Malonyl-CoA Decarboxylase Deficiency

Condition Gene/Varient
Malonyl-CoA Decarboxylase Deficiency Gene:MLYCD. Exons: NM_012213.2:2-5. Variants(1): c.560C>G

Mandibuloacral Dysplasia with type A lipodystrophy

Condition Gene/Varient
Mandibuloacral Dysplasia with type A lipodystrophy Gene:ZMPSTE24. Exons: NM_005857.4:1-10. Variants(5): c.1018T>C, c.743C>T, c.1349G>A, c.121C>T, c.1085_1086insT

Mandibuloacral Dysplasia with type B lipodystrophy

Condition Gene/Varient
Mandibuloacral Dysplasia with type B lipodystrophy Gene:LMNA. Exons: NM_170707.3:1-12. Variants(6): c.1586C>T, c.1626G>C, c.1411C>T, c.1318G>A, c.1580G>A, c.1579C>T

Maple Syrup Urine Disease Type 1A

Condition Gene/Varient
Maple Syrup Urine Disease Type 1A Gene:BCKDHA. Exons: NM_000709.3:1-9. Variants(3): c.1312T>A, c.117delC, c.868G>A

Maple Syrup Urine Disease Type 1B

Condition Gene/Varient
Maple Syrup Urine Disease Type 1B Gene:BCKDHB. Exons: NM_183050.2:1-10. Variants(6): c.356T>G, c.1039-7_1039-4delTCTG, c.832G>A, c.616C>T, c.1114G>T, c.548G>C

Maple Syrup Urine Disease Type 2

Condition Gene/Varient
Maple Syrup Urine Disease Type 2 Gene:DBT. Exons: NM_001918.3:1-11. Variants(5): c.1355A>G, c.1448G>T, c.294C>G, c.581C>G, c.827T>G

Maple Syrup Urine Disease Type 3

Condition Gene/Varient
Maple Syrup Urine Disease Type 3 Gene:DLD. Exons: NM_000108.3:1-14. Variants(3): c.105_106insA, c.685G>T, c.1483A>G

Marinesco-Sj?gren syndrome

Condition Gene/Varient
Marinesco-Sj?gren syndrome Gene:SIL1. Exons: NM_022464.4:2-10. Variants(3): c.1370T>C, c.1312C>T, c.331C>T G

Martsolf Syndrome

Condition Gene/Varient
Martsolf Syndrome Gene:RAB3GAP2. Exons: NM_012414.3:1-35. Variants(1): c.3154G>T

McKusick-Kaufman Syndrome

Condition Gene/Varient
McKusick-Kaufman Syndrome Gene:MKKS. Exons: NM_018848.3:3-6. Variants(3): c.724G>T, c.110A>G, c.250C>T

Meckel Syndrome 1

Condition Gene/Varient
Meckel Syndrome 1 Gene:MKS1. Exons: NM_017777.3:1-18. Variants(2): c.51_55dupCCGGG, c.80+2T>C

Meckel Syndrome 10

Condition Gene/Varient
Meckel Syndrome 10 Gene:B9D2. Exons: NM_030578.3:2-4. Variants(1): c.301A>

Meckel Syndrome 2

Condition Gene/Varient
Meckel Syndrome 2 Gene:TMEM216. Exons: NM_001173990.2:1-5. Variants(3): c.341T>G, c.253C>T, c.230G>C

Meckel Syndrome 3

Condition Gene/Varient
Meckel Syndrome 3 Gene:TMEM67. Exons: NM_153704.5:1-28. Variants(2): c.1127A>C, c.622A>

T Meckel Syndrome 4

Condition Gene/Varient
T Meckel Syndrome 4 Gene:CEP290. Exons: NM_025114.3:2-54. Variants(2): c.384_387delTAGA, c.613C>T

Meckel Syndrome 5

Condition Gene/Varient
Meckel Syndrome 5 Gene:RPGRIP1L. Exons: NM_015272.2:2-22,24-27. Variants(3): c.2614C>T, c.1033C>T, c.394A>T

MECP2-Related Severe Neonatal Encephalopathy

Condition Gene/Varient
MECP2-Related Severe Neonatal Encephalopathy Gene:MECP2. Exons: NM_004992.3:2-4. Variants(6): c.410A>G, c.964C>T, c.419C>T, c.1282G>A, c.1180G>T, c.674C>T

Megalencephalic Leukoencephalopathy with Subcortical Cysts 1

Condition Gene/Varient
Megalencephalic Leukoencephalopathy with Subcortical Cysts 1 Gene:MLC1. Exons: NM_015166.3:2-12. Variants(8): c.278C>T, c.422A>G, c.274C>T, c.839C>T, c.423C>A, c.206C>T, c.135_136insC, c.178-10T>A

Metachromatic Leukodystrophy due to Arylsulfatase A

Condition Gene/Varient
Metachromatic Leukodystrophy due to Arylsulfatase A Gene:ARSA. Exons: NM_000487.5:1-8. Variants(12): c.1283C>T, c.769G>C, c.465+1G>A, c.257G>A, c.1401_1411delGTTAGACGCAG, c.739G>A, c.1232C>T, c.1210+1G>A, c.293C>T, c.641C>T, c.542T>G, c.302G>A

Metachromatic Leukodystrophy due to Saposin B Deficiency

Condition Gene/Varient
Metachromatic Leukodystrophy due to Saposin B Deficiency Gene:PSAP. Exons: NM_002778.2:1-14. Variants(2): c.722G>C, c.643A>C

Methylmalonic Aciduria and Homocystinuria CblC type

Condition Gene/Varient
Methylmalonic Aciduria and Homocystinuria CblC type Gene:MMACHC. Exons: NM_015506.2:1-4. Variants(6): c.331C>T, c.394C>T, c.440G>C, c.482G>A, c.347T>C, c.271dupA

Methylmalonic Aciduria and Homocystinuria CblD type

Condition Gene/Varient
Methylmalonic Aciduria and Homocystinuria CblD type Gene:MMADHC. Exons: NM_015702.2:2-8. Variants(7): c.746A>G, c.748C>T, c.545C>A, c.160C>T, c.776T>C, c.419dupA, c.57_64delCTCTTTAG

Mevalonic Aciduria

Condition Gene/Varient
Mevalonic Aciduria Gene:MVK. Exons: NM_000431.2:2-11. Variants(3): c.1000G>A, c.902A>C, c.928G>A

Microphthalmia with coloboma 8/Syndromic Microphthalmia 9

Condition Gene/Varient
Microphthalmia with coloboma 8/Syndromic Microphthalmia 9 Gene:STRA6. Exons: NM_022369.3:2-19. Variants(12): c.527_528insG, c.1678G>C, c.910_911delGGinsAA, c.1931C>T, c.878C>T, c.1521-1G>A, c.52_53delTAinsC, c.1964G>A, c.1963C>T, c.147delC, c.69G>A, c.277_278insCC

Minicore Myopathy With External Ophthalmoplegia

Condition Gene/Varient
Minicore Myopathy With External Ophthalmoplegia Gene:RYR1. Exons: NM_000540.2:1-90,92-106. Variants(6): c.1739_1742dupATCA, c.10343C>T, c.7268T>A, c.325C>T, c.14365-2A>T, c.5726_5727delAG

Mitochondrial Complex III Deficiency Nuclear Type 1

Condition Gene/Varient
Mitochondrial Complex III Deficiency Nuclear Type 1 Gene:BCS1L. Exons: NM_004328.4:3-9. Variants(7): c.830G>A, c.296C>T, c.1057G>A, c.547C>T, c.464G>C, c.148A>G, c.133C>T

Mitochondrial Complex III Deficiency nuclear Type 3

Condition Gene/Varient
Mitochondrial Complex III Deficiency nuclear Type 3 Gene:UQCRB. Exons: NM_006294.4:1-4. Variants(1): c.306_309delAAAA

Mitochondrial Complex III Deficiency nuclear Type 4

Condition Gene/Varient
Mitochondrial Complex III Deficiency nuclear Type 4 Gene:UQCRQ. Exons: NM_014402.4:2-3. Variants(1): c.134C>T

Mitochondrial DNA depletion Syndrome 2

Condition Gene/Varient
Mitochondrial DNA depletion Syndrome 2 Gene:TK2. Exons: NM_004614.4:2-10. Variants(5): c.323C>T, c.361C>A, c.159C>G, c.268C>T, c.635T>A

Mitochondrial DNA depletion Syndrome 3

Condition Gene/Varient
Mitochondrial DNA depletion Syndrome 3 Gene:DGUOK. Exons: NM_080916.2:1-7. Variants(4): c.679G>A, c.425G>A, c.763G>T, c.313C>T

Mitochondrial DNA depletion Syndrome 6

Condition Gene/Varient
Mitochondrial DNA depletion Syndrome 6 Gene:MPV17. Exons: NM_002437.4:2-8. Variants(5): c.498C>A, c.149G>A, c.359G>A, c.148C>T, c.70G>T

Mitochondrial DNA depletion Syndrome 9

Condition Gene/Varient
Mitochondrial DNA depletion Syndrome 9 Gene:SUCLG1. Exons: NM_003849.3:1-8. Variants(3): c.626C>A, c.97+3G>C, c.152_153delAT

Miyoshi Myopathy

Condition Gene/Varient
Miyoshi Myopathy Gene:DYSF. Exons: NM_003494.3:1-35,37-55. Variants(7): c.895G>T, c.6124C>T, c.1555G>A, c.1813C>T, c.5713C>T, c.2997G>T, c.3137G>A

MMAA-Related Methylmalonic Acidemia

Condition Gene/Varient
MMAA-Related Methylmalonic Acidemia Gene:MMAA. Exons: NM_172250.2:2-7. Variants(4): c.503delC, c.433C>T, c.283C>T, c.620A>G

MMAB-Related Methylmalonic Acidemia

Condition Gene/Varient
MMAB-Related Methylmalonic Acidemia Gene:MMAB. Exons: NM_052845.3:1-9. Variants(3): c.548A>T, c.556C>T, c.569G>A

Mohr-Tranebjaerg Syndrome

Condition Gene/Varient
Mohr-Tranebjaerg Syndrome Gene:TIMM8A. Exons: NM_004085.3:1-2. Variants(3): c.112C>T, c.238C>T, c.198C>G

Molybdenum Cofactor Deficiency A

Condition Gene/Varient
Molybdenum Cofactor Deficiency A Gene:MOCS1. Exons: NM_005943.5:1-9. Variants(2): c.956G>A, c.217C>T

Molybdenum Cofactor Deficiency B

Condition Gene/Varient
Molybdenum Cofactor Deficiency B Gene:MOCS2. Exons: NM_176806.2:1-3. Variants(3): c.*422G>A, c.16C>T, c.*487A>C

MORM Syndrome

Condition Gene/Varient
MORM Syndrome Gene:INPP5E. Exons: NM_019892.4:1-10. Variants(1): c.1879C>T

MTHFR deficiency

Condition Gene/Varient
MTHFR deficiency Gene:MTHFR. Exons: NM_005957.4:2-12. Variants(6): c.1743G>A, c.1015T>G, c.968T>C, c.547C>T, c.1129C>T, c.971A>G

Mucolipidosis II

Condition Gene/Varient
Mucolipidosis II Gene:GNPTAB. Exons: NM_024312.4:1-21. Variants(6): c.3173C>G, c.2681G>A, c.3503_3504delTC, c.1196C>T, c.310C>T, c.3565C>T

Mucolipidosis IV

Condition Gene/Varient
Mucolipidosis IV Gene:MCOLN1. Exons: NM_020533.2:2-14. Variants(5): c.1084G>T, c.1207C>T, c.964C>T, c.304C>T, c.406-2A>G

Mucopolysaccharidosis Type I

Condition Gene/Varient
Mucopolysaccharidosis Type I Gene:IDUA. Exons: NM_000203.3:2-8,12-14. Variants(8): c.1960T>G, c.1037T>G, c.1855C>G, c.266G>A, c.1206G>A, c.1861C>T, c.208C>T, c.192C>A

Mucopolysaccharidosis Type II

Condition Gene/Varient
Mucopolysaccharidosis Type II Gene:IDS. Exons: NM_000202.5:1-2,4-9. Variants(9): c.1425G>A, c.1464G>T, c.1327C>T, c.514C>T, c.1466G>C, c.1402C>T, c.1403G>T, c.1403G>A, c.998C>T

Mucopolysaccharidosis Type IIIA

Condition Gene/Varient
Mucopolysaccharidosis Type IIIA Gene:SGSH. Exons: NM_000199.3:2-8. Variants(10): c.1105G>A, c.892T>C, c.197C>G, c.1298G>A, c.383C>T, c.449G>A, c.1339G>A, c.220C>T, c.734G>A, c.617G>C

Mucopolysaccharidosis Type IIIC

Condition Gene/Varient
Mucopolysaccharidosis Type IIIC Gene:HGSNAT. Exons: NM_152419.2:2-18. Variants(8): c.1030C>T, c.493+1G>A, c.962T>G, c.1345dupG, c.525dupT, c.1553C>T, c.848C>T, c.372-2A>G

Mucopolysaccharidosis Type IIID

Condition Gene/Varient
Mucopolysaccharidosis Type IIID Gene:GNS. Exons: NM_002076.3:1-14. Variants(4): c.1169delA, c.1063C>T, c.1226dupG, c.1168C>T

Mucopolysaccharidosis Type IVB

Condition Gene/Varient
Mucopolysaccharidosis Type IVB Gene:GLB1. Exons: NM_000404.2:1-16. Variants(6): c.1527G>T, c.818G>T, c.1313G>A, c.1223A>C, c.1444C>T, c.1498A>G

Mucopolysaccharidosis Type VI

Condition Gene/Varient
Mucopolysaccharidosis Type VI Gene:ARSB. Exons: NM_000046.3:2-8. Variants(6): c.629A>G, c.349T>C, c.410G>T, c.707T>C, c.1178A>C, c.1214G>A

Mucopolysaccharidosis Type VII

Condition Gene/Varient
Mucopolysaccharidosis Type VII Gene:GUSB. Exons: NM_000181.3:1-12. Variants(15): c.442C>T, c.646C>T, c.526C>T, c.1061C>T, c.1144C>T, c.1831C>T, c.1244+1G>A, c.1338G>A, c.1069C>T, c.1484A>G, c.1050G>C, c.1881G>T, c.1856C>T, c.1730G>T, c.1521G>A

Mulibrey Nanism

Condition Gene/Varient
Mulibrey Nanism Gene:TRIM37. Exons: NM_015294.3:1-24. Variants(14): c.860G>A, c.2056C>T, c.227T>C, c.2212delG, c.1411C>T, c.1894_1895delGA, c.965G>T, c.855_860+2delTTTCAGGT, c.1346_1347insA, c.838_842delACTTT, c.326G>C, c.1037_1040dupAGAT, c.745C>T, c.496_500delAGGAA

Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A1

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A1 Gene:POMT1. Exons: NM_007171.3:2- 20. Variants(2): c.226G>A, c.907C>T

Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A2

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A2 Gene:POMT2. Exons: NM_013382.5:1- 21. Variants(5): c.1117G>T, c.2177G>A, c.1238G>C, c.1912C>T, c.1057G>A

Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A3

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A3 Gene:POMGNT1. Exons: NM_017739.3:2-22. Variants(7): c.932G>A, c.1425G>A, c.1539+1G>A, c.1539+1G>T, c.187C>T, c.652+1G>A, c.1864delC

Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A4

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) Type A4 Gene:FKTN. Exons: NM_001079802.1:3-11. Variants(2): c.509C>A, c.1112A>G

Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) type A6

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with brain and eye anomalies) type A6 Gene:LARGE. Exons: NM_004737.4:3- 16. Variants(2): c.1483T>C, c.992C>T

Muscular Dystrophy-Dystroglycanopathy (Congenital with Mental retardation) Type B1

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (Congenital with Mental retardation) Type B1 Gene:POMT1. Exons: NM_007171.3:2- 20. Variants(6): c.2163C>A, c.2005G>A, c.1540C>T, c.1746G>C, c.193G>A, c.1770G>C

Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) Type B2

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) Type B2 Gene:POMT2. Exons: NM_013382.5:1- 21. Variants(4): c.1941G>A, c.1997A>G, c.2242T>C, c.1445G>T

Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) Type B3

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) Type B3 Gene:POMGNT1. Exons: NM_017739.3:2- 22. Variants(2): c.1469G>A, c.1814G>C

Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) type B6

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (congenital with mental retardation) type B6 Gene:LARGE. Exons: NM_004737.4:3- 16. Variants(1): c.1525G>A

Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C1

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C1 Gene:POMT1. Exons: NM_007171.3:2-20. Variants(1): c.598G>C

Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C2

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C2 Gene:POMT2. Exons: NM_013382.5:1-21. Variants(2): c.551C>T, c.2243G>C

Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C4

Condition Gene/Varient
Muscular Dystrophy-Dystroglycanopathy (limb-girdle) Type C4 Gene:FKTN. Exons: NM_001079802.1:3-11. Variants(3): c.340G>A, c.527T>C, c.920G>A

MUT-Related Methylmalonic Acidemia

Condition Gene/Varient
MUT-Related Methylmalonic Acidemia Gene:MUT. Exons: NM_000255.3:2-13. Variants(10): c.2150G>T, c.2080C>T, c.313T>C, c.655A>T, c.1105C>T, c.278G>A, c.1867G>A, c.322C>T, c.643G>A, c.682C>T

Myopathy with Deficiency of ISCU. Gene:ISCU. Exons: NM_213595.2:2-5. Variants(1): c.149G>A Myotonia Congenita

Condition Gene/Varient
Myopathy with Deficiency of ISCU. Gene:ISCU. Exons: NM_213595.2:2-5. Variants(1): c.149G>A Myotonia Congenita Gene:CLCN1. Exons: NM_000083.2:1-23. Variants(5): c.501C>G, c.1238T>G, c.1453A>G, c.871G>A, c.2680C>T

N-acetylglutamate synthase deficiency

Condition Gene/Varient
N-acetylglutamate synthase deficiency Gene:NAGS. Exons: NM_153006.2:2-7. Variants(6): c.971G>A, c.916-2A>T, c.1025delG, c.1299G>C, c.1307dupT, c.1289T>C

Nanophthalmos 2

Condition Gene/Varient
Nanophthalmos 2 Gene:MFRP. Exons: NM_031433.2:1-13. Variants(4): c.1150_1151insC, c.545T>C, c.523C>T, c.498delC

Nemaline Myopathy 2

Condition Gene/Varient
Nemaline Myopathy 2 Gene:NEB. Exons: NM_004543.4:3-56,58-60,62-65,68-150. Variants(3): c.18318_18319delAG, c.19606G>T, c.19119_19120delGA

Nemaline Myopathy 5

Condition Gene/Varient
Nemaline Myopathy 5 Gene:TNNT1. Exons: NM_003283.4:2-3,5-14. Variants(1): c.538G>

T Nephronophthisis 1

Condition Gene/Varient
T Nephronophthisis 1 Gene:NPHP1. Exons: NM_000272.3:1-20. Variants(2): c.1884+1G>T, c.80T>

A Nephronophthisis 11

Condition Gene/Varient
A Nephronophthisis 11 Gene:TMEM67. Exons: NM_153704.5:1-28. Variants(4): c.2461G>A, c.1843T>C, c.869G>T, c.2461G>C

Nephronophthisis 2

Condition Gene/Varient
Nephronophthisis 2 Gene:INVS. Exons: NM_014425.3:2-17. Variants(5): c.1453delC, c.2695C>T, c.2719C>T, c.1478T>C, c.1807C>T

Nephropathic Cystinosis

Condition Gene/Varient
Nephropathic Cystinosis Gene:CTNS. Exons: NM_004937.2:3-12. Variants(10): c.969C>G, c.397_398delAT, c.357_360delCAGC, c.414G>A, c.853-3C>G, c.329G>T, c.1015G>A, c.416C>T, c.473T>C, c.283G>T

Nephrotic Syndrome Type 1

Condition Gene/Varient
Nephrotic Syndrome Type 1 Gene:NPHS1. Exons: NM_004646.3:1-29. Variants(10): c.1481delC, c.2456A>T, c.121_122delCT, c.1307_1308dupAC, c.3250_3251insG, c.2464G>A, c.3478C>T, c.3325C>T, c.3250delG, c.793T>C

Nephrotic Syndrome Type 2

Condition Gene/Varient
Nephrotic Syndrome Type 2 Gene:NPHS2. Exons: NM_014625.2:1-8. Variants(1): c.413G>A

Nephrotic Syndrome Type 3

Condition Gene/Varient
Nephrotic Syndrome Type 3 Gene:PLCE1. Exons: NM_016341.3:2-32. Variants(8): c.4846C>T, c.3736C>T, c.961C>T, c.3846delG, c.3346C>T, c.1477C>T, c.4451C>T, c.5560C>T

Neurodegeneration With Brain Iron Accumulation 2

Condition Gene/Varient
Neurodegeneration With Brain Iron Accumulation 2 Gene:PLA2G6. Exons: NM_003560.2:2-17. Variants(6): c.2370T>G, c.1894C>T, c.1634A>C, c.109C>T, c.929T>A, c.238G>

A Neuronal Ceroid-Lipofuscinoses 1

Condition Gene/Varient
A Neuronal Ceroid-Lipofuscinoses 1 Gene:PPT1. Exons: NM_000310.3:1-9. Variants(7): c.29T>A, c.223A>C, c.169_170insA, c.322G>C, c.236A>G, c.451C>T, c.364A>T

Neuronal Ceroid-Lipofuscinoses 10

Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 10 Gene:CTSD. Exons: NM_001909.4:2-9. Variants(2): c.1149G>C, c.685T>A

Neuronal Ceroid-Lipofuscinoses 2

Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 2 Gene:TPP1. Exons: NM_000391.3:1-13. Variants(8): c.1340G>A, c.616C>T, c.857A>G, c.509-1G>C, c.1094G>A, c.622C>T, c.1093T>C, c.851G>T

Neuronal Ceroid-Lipofuscinoses 3

Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 3 Gene:CLN3. Exons: NM_001042432.1:2-16. Variants(2): c.597C>A, c.883G>A

Neuronal Ceroid-Lipofuscinoses 4A

Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 4A Gene:CLN6. Exons: NM_017882.2:2-7. Variants(3): c.308G>A, c.139C>T, c.200T>C

Neuronal Ceroid-Lipofuscinoses 5

Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 5 Gene:CLN5. Exons: NM_006493.2:1-4. Variants(2): c.1175_1176delAT, c.1054G>T

Neuronal Ceroid-Lipofuscinoses 6

I am text block. Click edit button to change this text. Lorem ipsum dolor Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 6 Gene:CLN6. Exons: NM_017882.2:2-7. Variants(3): c.316_317insC, c.214G>T, c.663C>G

Neuronal Ceroid-Lipofuscinoses 7

Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 7 Gene:MFSD8. Exons: NM_152778.2:2-13. Variants(6): c.1235C>T, c.1286G>A, c.362A>G, c.894T>G, c.881C>A, c.929G>A

Neuronal Ceroid-Lipofuscinoses 8

Condition Gene/Varient
Neuronal Ceroid-Lipofuscinoses 8 Gene:CLN8. Exons: NM_018941.3:2-3. Variants(5): c.611G>T, c.88G>C, c.789G>C, c.88delG, c.70C>G

Niemann-Pick Disease Type A

Condition Gene/Varient
Niemann-Pick Disease Type A Gene:SMPD1. Exons: NM_000543.4:1-6. Variants(5): c.1493G>T, c.996delC, c.1152G>A, c.911T>C, c.788T>A

Niemann-Pick Disease Type B

Condition Gene/Varient
Niemann-Pick Disease Type B Gene:SMPD1. Exons: NM_000543.4:1-6. Variants(3): c.1327C>T, c.1829_1831delGCC, c.1267C>T

Niemann-Pick Disease Type C1

Condition Gene/Varient
Niemann-Pick Disease Type C1 Gene:NPC1. Exons: NM_000271.4:2-25. Variants(16): c.3467A>G, c.3662delT, c.3263A>G, c.337T>C, c.2974G>A, c.2848G>A, c.3611_3614delTTAC, c.3107C>T, c.2873G>A, c.3104C>T, c.3175C>T, c.2932C>T, c.530G>A, c.2974G>T, c.3591+1G>A, c.3182T>C

Niemann-Pick Disease Type C2

Condition Gene/Varient
Niemann-Pick Disease Type C2 Gene:NPC2. Exons: NM_006432.3:1-5. Variants(11): c.441+1G>A, c.358C>T, c.27delG, c.111delG, c.199T>C, c.436C>T, c.82+2T>C, c.58G>T, c.352G>T, c.190+5G>A, c.115G>A

Night blindness, congenital stationary (complete) 1B, Autosomal Recessive

Condition Gene/Varient
Night blindness, congenital stationary (complete) 1B, Autosomal Recessive Gene:GRM6. Exons: NM_000843.3:2-10. Variants(7): c.2341G>A, c.719_720insG, c.727_728insG, c.2122C>T, c.1214T>C, c.1565G>A, c.1861C>T

Night blindness, congenital stationary (complete) 1E, Autosomal Recessive

Condition Gene/Varient
Night blindness, congenital stationary (complete) 1E, Autosomal Recessive Gene:GPR179. Exons: NM_001004334.2:1-11. Variants(6): c.278delC, c.187delC, c.598C>T, c.1784+1G>A, c.984delC, c.1807C>T

Night blindness, congenital stationary (complete)1A

Condition Gene/Varient
Night blindness, congenital stationary (complete)1A Gene:NYX. Exons: NM_022567.2:1. Variants(1): c.1049G>A Night blindness, congenital stationary (complete)1D. Gene:SLC24A1. Exons: NM_004727.2:2-10. Variants(1): c.1613_1614delTT

Nijmegen breakage syndrome

Condition Gene/Varient
Nijmegen breakage syndrome Gene:NBN. Exons: NM_002485.4:1-16. Variants(1): c.657_661delACAAA

Oculocutaneous Albinism Type 1

Condition Gene/Varient
Oculocutaneous Albinism Type 1 Gene:TYR. Exons: NM_000372.4:1-4. Variants(30): c.823G>T, c.1118C>A, c.265T>C, c.1012_1013insC, c.272G>A, c.1501dupC, c.896G>A, c.1A>G, c.230G>A, c.1164delT, c.572delG, c.707G>A, c.1209G>T, c.1265G>A, c.1336G>A, c.164G>A, c.140G>A, c.649C>T, c.1217C>T, c.1255G>A, c.1147G>A, c.616G>A, c.1146C>A, c.650G>A, c.1467dupT, c.242C>T, c.1342G>A, c.533G>A, c.732_733delTG, c.286dupA

Oculocutaneous Albinism Type 2

Condition Gene/Varient
Oculocutaneous Albinism Type 2 Gene:OCA2. Exons: NM_000275.2:2-24. Variants(8): c.79G>A, c.2037G>C, c.1465A>G, c.1960delG, c.1842+1G>T, c.1327G>A, c.2228C>T, c.1182G>A

Oculocutaneous Albinism Type 3

Condition Gene/Varient
Oculocutaneous Albinism Type 3 Gene:TYRP1. Exons: NM_000550.2:2-8. Variants(6): c.1120C>T, c.1103delA, c.107delT, c.497C>G, c.1057_1060delAACA, c.1067G>A

Oculocutaneous Albinism Type 4

Condition Gene/Varient
Oculocutaneous Albinism Type 4 Gene:SLC45A2. Exons: NM_016180.3:1-7. Variants(3): c.986delC, c.469G>A, c.1121delT

Odontoonychodermal Dysplasia

Condition Gene/Varient
Odontoonychodermal Dysplasia Gene:WNT10A. Exons: NM_025216.2:1-3. Variants(3): c.321C>A, c.697G>T, c.383G>A

Oguchi Disease-1

Condition Gene/Varient
Oguchi Disease-1 Gene:SAG. Exons: NM_000541.4:2-16. Variants(5): c.926delA, c.577C>T, c.523C>T, c.874C>T, c.916G>T

Ohdo Syndrome

Condition Gene/Varient
Ohdo Syndrome Gene:MED12. Exons: NM_005120.2:1-41,43-45. Variants(3): c.5185C>A, c.3443G>A, c.3493T>C

Ornithine Transcarbamylase Deficiency

Condition Gene/Varient
Ornithine Transcarbamylase Deficiency Gene:OTC. Exons: NM_000531.5:1-10. Variants(14): c.386G>A, c.77G>A, c.829C>T, c.617T>G, c.332T>C, c.119G>A, c.646C>G, c.717+2T>C, c.259G>A, c.118C>T, c.148G>T, c.674C>T, c.460G>T, c.134T>C

Osteogenesis Imperfecta Type VII

Condition Gene/Varient
Osteogenesis Imperfecta Type VII Gene:CRTAP. Exons: NM_006371.4:2-7. Variants(2): c.561T>G, c.826C>T

Osteogenesis Imperfecta Type VIII

Condition Gene/Varient
Osteogenesis Imperfecta Type VIII Gene:LEPRE1. Exons: NM_022356.3:1-15. Variants(6): c.747delC, c.1080+1G>T, c.1473+1G>T, c.1102C>T, c.1365_1366delAGinsC, c.1656C>A

Osteoporosis-Pseudoglioma Syndrome

Condition Gene/Varient
Osteoporosis-Pseudoglioma Syndrome Gene:LRP5. Exons: NM_002335.2:2-23. Variants(9): c.1282C>T, c.1481G>A, c.1468delG, c.2202G>A, c.1453G>T, c.2305delG, c.1708C>T, c.1584+1G>A, c.2557C>T

Pancreatic Agenesis

Condition Gene/Varient
Pancreatic Agenesis Gene:PDX1. Exons: NM_000209.3:1. Variants(3): c.492G>T, c.533A>G, c.532G>A

Pantothenate Kinase-Associated Neurodegeneration

Condition Gene/Varient
Pantothenate Kinase-Associated Neurodegeneration Gene:PANK2. Exons: NM_153638.2:1-7. Variants(5): c.790C>T, c.570C>G, c.1583C>T, c.1561G>A, c.533C>A

PCCA-Related Propionic Acidemia

Condition Gene/Varient
PCCA-Related Propionic Acidemia Gene:PCCA. Exons: NM_000282.3:1-24. Variants(3): c.1891G>C, c.412G>A, c.862A>T

PCCB-Related Propionic Acidemia

Condition Gene/Varient
PCCB-Related Propionic Acidemia Gene:PCCB. Exons: NM_000532.4:1-15. Variants(9): c.1283C>T, c.1173_1174insT, c.1228C>T, c.737G>T, c.1495C>T, c.502G>A, c.1534C>T, c.1304A>G, c.1540_1541insCCC

Pelizaeus-Merzbacher Disease

Condition Gene/Varient
Pelizaeus-Merzbacher Disease Gene:PLP1. Exons: NM_000533.3:1-7. Variants(3): c.169G>T, c.725C>T, c.3G>A

Peroxisomal acyl-CoA oxidase deficiency

Condition Gene/Varient
Peroxisomal acyl-CoA oxidase deficiency Gene:ACOX1. Exons: NM_004035.6:1-14. Variants(4): c.442C>T, c.832A>G, c.926A>G, c.532G>T

Peroxisome biogenesis disorder 1

Condition Gene/Varient
Peroxisome biogenesis disorder 1 Gene:PEX1. Exons: NM_000466.2:1-24. Variants(4): c.2097_2098insT, c.1991T>C, c.2916delA, c.2528G>A

Peroxisome biogenesis disorder 2

Condition Gene/Varient
Peroxisome biogenesis disorder 2 Gene:PEX5. Exons: NM_001131025.1:2-16. Variants(2): c.1279C>T, c.1578T>G

Peroxisome biogenesis disorder 3

Condition Gene/Varient
Peroxisome biogenesis disorder 3 Gene:PEX12. Exons: NM_000286.2:1-3. Variants(3): c.691A>T, c.538C>T, c.959C>T

Peroxisome biogenesis disorder 5

Condition Gene/Varient
Peroxisome biogenesis disorder 5 Gene:PEX2. Exons: NM_000318.2:4. Variants(2): c.163G>A, c.355C>T

Peroxisome biogenesis disorder 6

Condition Gene/Varient
Peroxisome biogenesis disorder 6 Gene:PEX10. Exons: NM_153818.1:2-6. Variants(2): c.704_705insA, c.373C>T

Peroxisome biogenesis disorder 7

Condition Gene/Varient
Peroxisome biogenesis disorder 7 Gene:PEX26. Exons: NM_017929.5:2-6. Variants(5): c.254dupT, c.265G>A, c.34_35insC, c.292C>T, c.2T>C

Phenylketonuria

Condition Gene/Varient
Phenylketonuria Gene:PAH. Exons: NM_000277.1:1-13. Variants(203): c.165T>G, c.208_210delTCT, c.464G>A, c.932T>C, c.727C>T, c.805A>C, c.1021A>T, c.618C>A, c.441+1G>A, c.168+1G>A, c.896T>G, c.353-1G>C, c.204A>T, c.1A>G, c.1056delT, c.694C>T, c.728G>A, c.754C>T, c.122T>C, c.581T>C, c.1157A>G, c.782G>A, c.662A>G, c.943G>T, c.678G>C, c.763T>G, c.977G>A, c.901C>T, c.559T>C, c.1089delG, c.721C>T, c.913-7A>G, c.775G>A, c.611A>G, c.997C>T, c.1200-8G>A, c.1084C>A, c.814G>T, c.1112A>G, c.1045T>C, c.975C>G, c.1232C>G, c.168+5G>A, c.558_559delAT, c.912+2T>C, c.818C>T, c.284_286delTCA, c.941C>A, c.1129delT, c.1055delG, c.608G>A, c.745C>T, c.442G>A, c.442-1G>A, c.841C>G, c.1197A>T, c.926C>A, c.136G>A, c.1161C>A, c.829T>G, c.183C>G, c.667A>T, c.691T>C, c.143T>C, c.1042C>G, c.1238G>C, c.737delC, c.1315+1G>A, c.911A>G, c.619A>G, c.1159T>C, c.842+5G>A, c.715G>A, c.491T>C, c.1315+6T>A, c.722delG, c.165delT, c.47_48delCT, c.1127delA, c.1172G>T, c.119C>T, c.439C>T, c.193A>G, c.671T>C, c.1196_1199delTAAG, c.1114A>T, c.521T>C, c.1220delC, c.1144T>C, c.482T>C, c.1315+2T>C, c.842+2T>A, c.398_401delATCA, c.355C>T, c.719T>C, c.838G>A, c.509+1G>A, c.58C>T, c.502T>C, c.806delT, c.826A>G, c.842+3G>C, c.740G>A, c.1289T>C, c.169-13T>G, c.1066-11G>A, c.241A>C, c.194T>A, c.968_970delCAA, c.442-2A>C, c.1200-1G>A, c.1315+4A>G, c.964G>A, c.960G>C, c.1200delG, c.111_112insC, c.503delA, c.1012G>T, c.776C>T, c.1199+1G>A, c.632delC, c.707-1G>A, c.789C>G, c.1180G>C, c.755G>A, c.692C>T, c.117C>G, c.884C>G, c.1199+2T>C, c.169-2A>G, c.199T>C, c.856G>A, c.529G>A, c.664_665delGA, c.953T>C, c.514C>T, c.970-2A>C, c.969+1G>A, c.724C>T, c.1183G>C, c.1006C>T, c.712A>C, c.441+3G>C, c.739G>A, c.259A>C, c.731C>T, c.847A>T, c.941delC, c.781C>T, c.1340C>A, c.580_581delCT, c.137delG, c.569T>C, c.635T>C, c.734T>A, c.1199G>A, c.733G>C, c.1033G>A, c.810A>T, c.473G>A, c.490A>G, c.208T>C, c.601C>T, c.916delA, c.665A>G, c.1229T>C, c.116_118delTCT, c.809G>A, c.648C>G, c.359G>A, c.264dupG, c.250G>T, c.1057delG, c.226G>T, c.842+1G>A, c.533A>G, c.907T>C, c.1301C>A, c.1222C>T, c.1024G>A, c.194T>C, c.441+5G>T, c.1024delG, c.508C>G, c.1065+1G>A, c.535T>C, c.1219C>T, c.1076C>G, c.331C>T, c.974A>G, c.889C>T, c.673C>A, c.311C>A, c.912+1G>A, c.1066-1G>A, c.764T>C, c.638T>C, c.890G>A, c.1220C>T, c.1068C>A, c.472C>T, c.1200-2A>G, c.842C>T

Phosphoribosylpyrophosphate Synthetase Superactivity

Condition Gene/Varient
Phosphoribosylpyrophosphate Synthetase Superactivity Gene:PRPS1. Exons: NM_002764.3:1-7. Variants(2): c.398A>C, c.455T>C

Phosphoserine Aminotransferase Deficiency

Condition Gene/Varient
Phosphoserine Aminotransferase Deficiency Gene:PSAT1. Exons: NM_058179.2:1-9. Variants(1): c.299A>C

POLG-Related Disorders

Condition Gene/Varient
POLG-Related Disorders Gene:POLG. Exons: NM_002693.2:2-23. Variants(18): c.695G>A, c.2591A>G, c.1879C>T, c.3218C>T, c.911T>G, c.2209G>C, c.679C>T, c.1399G>A, c.2557C>T, c.3630dupC, c.2243G>C, c.8G>C, c.752C>T, c.1491G>C, c.2794C>T, c.2T>C, c.2542G>A, c.2617G>T

Pontocerebellar Hypoplasia

Condition Gene/Varient
Pontocerebellar Hypoplasia Gene:TSEN54. Exons: NM_207346.2:3-11. Variants(3): c.919G>T, c.736C>T, c.1027C>T

Primary Autosomal Recessive Microcephaly 1

Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 1 Gene:MCPH1. Exons: NM_024596.3:1-14. Variants(5): c.74C>G, c.566_567insA, c.215C>T, c.302C>G, c.427_428insA

Primary Autosomal Recessive Microcephaly 2

Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 2 Gene:WDR62. Exons: NM_001083961.1:1-32. Variants(5): c.1313G>A, c.1531G>A, c.671G>C, c.193G>A, c.1408C>T

Primary Autosomal Recessive Microcephaly 3

Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 3 Gene:CDK5RAP2. Exons: NM_018249.4:1-38. Variants(6): c.4441C>T, c.4672C>T, c.246T>A, c.524_528delAGGCA, c.700G>T, c.4546G>

T Primary Autosomal Recessive Microcephaly 5

Condition Gene/Varient
T Primary Autosomal Recessive Microcephaly 5 Gene:ASPM. Exons: NM_018136.4:1-28. Variants(64): c.4795C>T, c.9677dupG, c.2389C>T, c.7491_7495delTATTA, c.3527C>G, c.1729_1730delAG, c.3477_3481delCGCTA, c.9697C>T, c.3188T>G, c.6189T>G, c.9730C>T, c.1590delA, c.6337_6338delAT, c.1366G>T, c.5136C>A, c.1406_1413delATCCTAAA, c.8844delC, c.7894C>T, c.7761T>G, c.9178C>T, c.3796G>T, c.9595A>T, c.719_720delCT, c.1002delA, c.9238A>T, c.577C>T, c.9539A>C, c.3811C>T, c.9190C>T, c.7782_7783delGA, c.5149delA, c.9557C>G, c.440delA, c.8131_8132delAA, c.10059C>A, c.8668C>T, c.9747_9748delCT, c.1260_1266delTCAAGTC, c.1179delT, c.3055C>T, c.3082G>A, c.9789T>A, c.1990C>T, c.2938C>T, c.3663delG, c.2967G>A, c.9492T>G, c.4858_4859delAT, c.9159delA, c.9319C>T, c.8378delT, c.3710C>G, c.8508_8509delGA, c.4195dupA, c.9115_9118dupCATT, c.1154_1155delAG, c.6732delA, c.9685delA, c.7860_7861delGA, c.3978G>A, c.349C>T, c.1959_1962delCAAA, c.9754delA, c.4583delA

Primary Autosomal Recessive Microcephaly 6

Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 6 Gene:CENPJ. Exons: NM_018451.4:2-17. Variants(3): c.3704A>T, c.3243_3246delTCAG, c.18delC

Primary Autosomal Recessive Microcephaly 7

Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 7 Gene:STIL. Exons: NM_003035.2:2-17. Variants(4): c.2826+1G>A, c.3715C>T, c.2392T>G, c.3655delG

Primary Autosomal Recessive Microcephaly 9

Condition Gene/Varient
Primary Autosomal Recessive Microcephaly 9 Gene:CEP152. Exons: NM_014985.3:2-26. Variants(1): c.794A>C

Primary Coenzyme Q10 deficiency 1

Condition Gene/Varient
Primary Coenzyme Q10 deficiency 1 Gene:COQ2. Exons: NM_015697.7:2-7. Variants(3): c.890A>G, c.683A>G, c.590G>A

Primary Coenzyme Q10 deficiency 2

Condition Gene/Varient
Primary Coenzyme Q10 deficiency 2 Gene:PDSS1. Exons: NM_014317.3:312. Variants(1): c.924T>G

Primary Coenzyme Q10 deficiency 3

Condition Gene/Varient
Primary Coenzyme Q10 deficiency 3 Gene:PDSS2. Exons: NM_020381.3:1-8. Variants(2): c.964C>T, c.1145C>T

Primary Coenzyme Q10 deficiency 4

Condition Gene/Varient
Primary Coenzyme Q10 deficiency 4 Gene:ADCK3. Exons: NM_020247.4:2-15. Variants(7): c.1645G>A, c.1541A>G, c.637C>T, c.1813_1814insG, c.815G>T, c.1651G>A, c.815G>A

Primary Hyperoxaluria Type I

Condition Gene/Varient
Primary Hyperoxaluria Type I Gene:AGXT. Exons: NM_000030.2:1-11. Variants(12): c.454T>A, c.322T>C, c.466G>A, c.731T>C, c.613T>C, c.560C>T, c.697C>T, c.121G>A, c.508G>A, c.738G>A, c.33_34insC, c.245G>A

Primary Hyperoxaluria Type II

Condition Gene/Varient
Primary Hyperoxaluria Type II Gene:GRHPR. Exons: NM_012203.1:1-9. Variants(3): c.103delG, c.295C>T, c.403_404+2delAAGT

Progressive Myoclonic Epilepsy 1A

Condition Gene/Varient
Progressive Myoclonic Epilepsy 1A Gene:CSTB. Exons: NM_000100.3:1-3. Variants(2): c.212A>C, c.202C>T

Pycnodysostosis

Condition Gene/Varient
Pycnodysostosis Gene:CTSK. Exons: NM_000396.3:2-8. Variants(5): c.721C>T, c.154A>T, c.236G>A, c.990A>G, c.926T>C

Pyridoxal 5'-Phosphate-dependent Epilepsy

Condition Gene/Varient
Pyridoxal 5′-Phosphate-dependent Epilepsy Gene:PNPO. Exons: NM_018129.3:1-7. Variants(2): c.685C>T, c.784T>C

Pyruvate Carboxylase Deficiency

Condition Gene/Varient
Pyruvate Carboxylase Deficiency Gene:PC. Exons: NM_000920.3:3-22. Variants(4): c.467G>A, c.1748G>T, c.434T>C, c.1828G>A

Pyruvate Dehydrogenase Phosphatase Deficiency

Condition Gene/Varient
Pyruvate Dehydrogenase Phosphatase Deficiency Gene:PDP1. Exons: NM_018444.3:2. Variants(2): c.851_853delTTC, c.277G>T

Pyruvate Kinase Deficiency

Condition Gene/Varient
Pyruvate Kinase Deficiency Gene:PKLR. Exons: NM_000298.5:1-11. Variants(8): c.110G>A, c.1261C>A, c.1675C>T, c.1529G>A, c.1151C>T, c.1436G>A, c.487C>T, c.1456C>T

Rabson-Mendenhall Syndrome

Condition Gene/Varient
Rabson-Mendenhall Syndrome Gene:INSR. Exons: NM_000208.2:2-22. Variants(1): c.3079C>T

RAG1-Related Omenn Syndrome

Condition Gene/Varient
RAG1-Related Omenn Syndrome Gene:RAG1. Exons: NM_000448.2:2. Variants(3): c.1682G>A, c.1681C>T, c.983G>A

RAG1-Related Severe Combined Immunodeficiency

Condition Gene/Varient
RAG1-Related Severe Combined Immunodeficiency Gene:RAG1. Exons: NM_000448.2:2. Variants(7): c.2320G>T, c.2164G>A, c.2326C>T, c.940C>T, c.2923C>T, c.2333G>A, c.2814T>G

RAG2-Related Severe Combined Immunodeficiency

Condition Gene/Varient
RAG2-Related Severe Combined Immunodeficiency Gene:RAG2. Exons: NM_000536.3:2. Variants(4): c.115A>G, c.1352G>C, c.230C>A, c.686G>A

Raine Syndrome

Condition Gene/Varient
Raine Syndrome Gene:FAM20C. Exons: NM_020223.3:2-10. Variants(6): c.1351G>A, c.1163T>G, c.1093G>C, c.1645C>T, c.838G>A, c.773T>A

RAPSN-Related Congenital Myasthenic Syndrome

Condition Gene/Varient
RAPSN-Related Congenital Myasthenic Syndrome Gene:RAPSN. Exons: NM_005055.4:1-8. Variants(5): c.264C>A, c.807C>A, c.490C>T, c.848T>C, c.484G>A

Refsum Disease

Condition Gene/Varient
Refsum Disease Gene:PHYH. Exons: NM_006214.3:2-9. Variants(13): c.497-2A>G, c.805A>C, c.678+5G>T, c.734G>A, c.135-2A>G, c.164delT, c.679-1G>T, c.823C>T, c.135-1G>C, c.824G>A, c.610G>A, c.530A>G, c.678+2T>G

Renal-Hepatic-Pancreatic Dysplasia

Condition Gene/Varient
Refsum Disease Gene:NPHP3. Exons: NM_153240.4:1-27. Variants(3): c.3340C>T, c.1985+5G>A, c.1729C>T

REN-Related Renal Tubular Dysgenesis

Condition Gene/Varient
REN-Related Renal Tubular Dysgenesis Gene:REN. Exons: NM_000537.3:1-10. Variants(4): c.689G>A, c.404C>A, c.127C>T, c.145C>T

Restrictive Dermopathy, Lethal

Condition Gene/Varient
Restrictive Dermopathy, Lethal Gene:ZMPSTE24. Exons: NM_005857.4:1-10. Variants(3): c.1085_1086insT, c.715G>T, c.54dupT

Retinal cone dystrophy 3B

Condition Gene/Varient
Retinal cone dystrophy 3B Gene:KCNV2. Exons: NM_133497.3:1-2. Variants(10): c.1016_1024delACCTGGTGG, c.8_11delAACA, c.916G>T, c.357_358insC, c.491T>C, c.767C>G, c.226C>T, c.1376G>A, c.427G>T, c.325C>T

Retinitis Pigmentosa 12

Condition Gene/Varient
Retinitis Pigmentosa 12 Gene:CRB1. Exons: NM_201253.2:1-12. Variants(6): c.2290C>T, c.2983G>T, c.3299T>C, c.3541T>C, c.2401A>T, c.3122T>C

Retinitis Pigmentosa 14

Condition Gene/Varient
Retinitis Pigmentosa 14 Gene:TULP1. Exons: NM_003322.3:1-15. Variants(6): c.1259G>C, c.1471T>C, c.1511_1521delTGCAGTTCGGC, c.99+1G>A, c.1376T>A, c.1444C>T

Retinitis Pigmentosa 19

Condition Gene/Varient
Retinitis Pigmentosa 19 Gene:ABCA4. Exons: NM_000350.2:1-50. Variants(3): c.1938-1G>A, c.1848delA, c.4539+1G>T

Retinitis Pigmentosa 2

Condition Gene/Varient
Retinitis Pigmentosa 2 Gene:RP2. Exons: NM_006915.2:1-5. Variants(7): c.358C>T, c.453delC, c.353G>T, c.305_306insT, c.353G>A, c.76C>T, c.453C>G

Retinitis Pigmentosa 20

Condition Gene/Varient
Retinitis Pigmentosa 20 Gene:RPE65. Exons: NM_000329.2:1-14. Variants(7): c.1543C>T, c.1087C>A, c.1355T>G, c.271C>T, c.394G>A, c.1102T>C, c.1022T>C

Retinitis Pigmentosa 25

Condition Gene/Varient
Retinitis Pigmentosa 25 Gene:EYS. Exons: NM_001142800.1:4-43. Variants(3): c.5928-2A>G, c.6714delT, c.5857G>T

Retinitis Pigmentosa 26

Condition Gene/Varient
Retinitis Pigmentosa 26 Gene:CERKL. Exons: NM_201548.4:1-13. Variants(4): c.420delT, c.598A>T, c.769C>T, c.780delT

Retinitis Pigmentosa 3

Condition Gene/Varient
Retinitis Pigmentosa 3 Gene:RPGR. Exons: NM_001034853.1:2-15. Variants(11): c.674_675delCC, c.179G>T, c.654_655delGA, c.823G>A, c.296C>A, c.389T>G, c.517G>C, c.173_174insA, c.846_847delAA, c.1433_1436delTGAC, c.703C>T

Retinitis Pigmentosa 35

Condition Gene/Varient
Retinitis Pigmentosa 35 Gene:SEMA4A. Exons: NM_022367.3:2-15. Variants(2): c.1033G>C, c.1049T>G

Retinitis Pigmentosa 36

Condition Gene/Varient
Retinitis Pigmentosa 36 Gene:PRCD. Exons: NM_001077620.2:1-3. Variants(2): c.5G>A, c.64C>T

Retinitis Pigmentosa 37

Condition Gene/Varient
Retinitis Pigmentosa 37 Gene:NR2E3. Exons: NM_014249.2:1-8. Variants(1): c.1034_1038delTGCAG

Retinitis Pigmentosa 38

Condition Gene/Varient
Retinitis Pigmentosa 38 Gene:MERTK. Exons: NM_006343.2:1-19. Variants(6): c.2323C>T, c.61+1G>A, c.2070_2074delAGGAC, c.2189+1G>T, c.1951C>T, c.1605-2A>G

Retinitis Pigmentosa 4

Condition Gene/Varient
Retinitis Pigmentosa 4 Gene:RHO. Exons: NM_000539.3:1-5. Variants(2): c.448G>A, c.745G>T

Retinitis Pigmentosa 40

Condition Gene/Varient
Retinitis Pigmentosa 40 Gene:PDE6B. Exons: NM_000283.3:1-22. Variants(4): c.1669C>T, c.1580T>C, c.1591C>T, c.892C>T

Retinitis Pigmentosa 41

Condition Gene/Varient
Retinitis Pigmentosa 41 Gene:PROM1. Exons: NM_006017.2:1-26. Variants(2): c.1726C>T, c.1841delG

Retinitis Pigmentosa 43

Condition Gene/Varient
Retinitis Pigmentosa 43 Gene:PDE6A. Exons: NM_000440.2:1-22. Variants(4): c.1683G>A, c.2053G>A, c.304C>A, c.1749C>G

Retinitis Pigmentosa 44

Condition Gene/Varient
Retinitis Pigmentosa 44 Gene:RGR. Exons: NM_001012720.1:1-7. Variants(1): c.196A>C Retinitis

Pigmentosa 45

Condition Gene/Varient
Pigmentosa 45 Gene:CNGB1. Exons: NM_001297.4:2-33. Variants(2): c.2978G>T, c.3462+1G>A

Retinitis Pigmentosa 46

Condition Gene/Varient
Pigmentosa 45 Gene:IDH3B. Exons: NM_006899.3:1-12. Variants(2): c.589delA, c.395T>C

Retinitis Pigmentosa 49

Condition Gene/Varient
Retinitis Pigmentosa 49 Gene:CNGA1. Exons: NM_000087.3:4-11. Variants(3): c.427A>T, c.959C>T, c.1972delA

Retinitis Pigmentosa 50

Condition Gene/Varient
Retinitis Pigmentosa 50 Gene:BEST1. Exons: NM_004183.3:2-11. Variants(1): c.418C>

G Retinitis Pigmentosa 56

Condition Gene/Varient
G Retinitis Pigmentosa 56 Gene:IMPG2. Exons: NM_016247.3:1-19. Variants(3): c.2716C>T, c.635C>G, c.2890C>T

Retinitis Pigmentosa 57

Condition Gene/Varient
Retinitis Pigmentosa 57 Gene:PDE6G. Exons: NM_002602.3:2-4. Variants(1): c.187+1G

T Retinitis Pigmentosa 59

Condition Gene/Varient
T Retinitis Pigmentosa 59 Gene:DHDDS. Exons: NM_024887.3:2-9. Variants(1): c.124A>G

Retinitis Pigmentosa 61

Condition Gene/Varient
Retinitis Pigmentosa 61 Gene:CLRN1. Exons: NM_174878.2:1-3. Variants(2): c.92C>T, c.461T>G

Retinitis Pigmentosa 62

Condition Gene/Varient
Retinitis Pigmentosa 62 Gene:MAK. Exons: NM_001242957.1:2-15. Variants(4): c.497G>A, c.388A>C, c.718C>T, c.37G>A

Retinitis Pigmentosa 65

Condition Gene/Varient
Retinitis Pigmentosa 65 Gene:CDHR1. Exons: NM_033100.2:2-17. Variants(3): c.1463delG, c.338delG, c.524dupA

Rhizomelic Chondrodysplasia Punctata Type 1

Condition Gene/Varient
Rhizomelic Chondrodysplasia Punctata Type 1 Gene:PEX7. Exons: NM_000288.3:2-10. Variants(7): c.903+1G>C, c.649G>A, c.618G>A, c.875T>A, c.653C>T, c.854A>G, c.694C>T

Rhizomelic Chondrodysplasia Punctata Type 3

Condition Gene/Varient
Rhizomelic Chondrodysplasia Punctata Type 3 Gene:AGPS. Exons: NM_003659.3:1-20. Variants(2): c.1703C>T, c.926C>T

Roberts Syndrome

Condition Gene/Varient
Roberts Syndrome Gene:ESCO2. Exons: NM_001017420.2:2-11. Variants(10): c.876_879delCAGA, c.1597dupT, c.751dupG, c.1111_1112insG, c.308_309delAA, c.764_765delTT, c.745_746delGT, c.879_880delAG, c.1615T>G, c.505C>T

RYR1 -Related Congenital Fiber-Type Disproportion

Condition Gene/Varient
RYR1 -Related Congenital Fiber-Type Disproportion Gene:ESCO2. Exons: NM_001017420.2:2-11. Variants(10): c.876_879delCAGA, c.1597dupT, c.751dupG, c.1111_1112insG, c.308_309delAA, c.764_765delTT, c.745_746delGT, c.879_880delAG, c.1615T>G, c.505C>T

Salla Disease

Condition Gene/Varient
Salla Disease Gene:SLC17A5. Exons: NM_012434.4:1-11. Variants(2): c.406A>G, c.115C>T

Sandhoff Disease

Condition Gene/Varient
Sandhoff Disease Gene:HEXB. Exons: NM_000521.3:1-14. Variants(4): c.1367A>C, c.1250C>T, c.965delT, c.850C>T

SC Phocomelia Syndrome

Condition Gene/Varient
SC Phocomelia Syndrome Gene:ESCO2. Exons: NM_001017420.2:2-11. Variants(4): c.604C>T, c.760_761insA, c.760delA, c.1269G>A

Schindler Disease

Condition Gene/Varient
Schindler Disease Gene:NAGA. Exons: NM_000262.2:1-9. Variants(1): c.973G>A

Schinzel phocomelia syndrome

Condition Gene/Varient
Schinzel phocomelia syndrome Gene:WNT7A. Exons: NM_004625.3:1-4. Variants(2): c.610G>A, c.874C>T

Schneckenbecken Dysplasia

Condition Gene/Varient
Schneckenbecken Dysplasia Gene:SLC35D1. Exons: NM_015139.2:1-12. Variants(3): c.932G>A, c.193A>C, c.319C>T

Schwartz-Jampel Syndrome Type 1

Condition Gene/Varient
Schwartz-Jampel Syndrome Type 1 Gene:HSPG2. Exons: NM_005529.5:2-97. Variants(2): c.4595G>A, c.8464+4A>G

SCNN1A-Related Autosomal Recessive Pseudohypoaldosteronism type 1

Condition Gene/Varient
SCNN1A-Related Autosomal Recessive Pseudohypoaldosteronism type 1 Gene:SCNN1A. Exons: NM_001038.5:2-13. Variants(1): c.1522C>T

SCNN1B-Related Autosomal Recessive Pseudohypoaldosteronism type 1

Condition Gene/Varient
SCNN1B-Related Autosomal Recessive Pseudohypoaldosteronism type 1 Gene:SCNN1B. Exons: NM_000336.2:2-13. Variants(1): c.109G>A

SCNN1G-Related Autosomal Recessive Pseudohypoaldosteronism type 1

Condition Gene/Varient
SCNN1G-Related Autosomal Recessive Pseudohypoaldosteronism type 1 Gene:SCNN1G. Exons: NM_001039.3:2-13. Variants(2): c.1627delG, c.1570-1G>A

Seckel Syndrome 1

Condition Gene/Varient
Seckel Syndrome 1 Gene:ATR. Exons: NM_001184.3:1-47. Variants(1): c.5635G>T

Seckel syndrome 5

Condition Gene/Varient
Seckel syndrome 5 Gene:CEP152. Exons: NM_014985.3:2-26. Variants(1): c.2034T>G

Senior-Loken Syndrome 4

Condition Gene/Varient
Senior-Loken Syndrome 4 Gene:NPHP4. Exons: NM_015102.3:2-30. Variants(2): c.2335C>T, c.1972C>T

Senior-Loken Syndrome 5

Condition Gene/Varient
Senior-Loken Syndrome 5 Gene:IQCB1. Exons: NM_001023570.2:3-15. Variants(4): c.1465C>T, c.1069C>T, c.1036G>T, c.1381C>T

SEPN1-related Congenital Muscular Dystrophy

Condition Gene/Varient
SEPN1-related Congenital Muscular Dystrophy Gene:SEPN1. Exons: NM_020451.2:2,4-13. Variants(6): c.1385G>A, c.1358G>C, c.1384T>G, c.943G>A, c.1397G>A, c.818G>A

Septo-Optic Dysplasia

Condition Gene/Varient
Septo-Optic Dysplasia Gene:HESX1. Exons: NM_003865.2:1-4. Variants(4): c.357+2T>C, c.478C>T, c.450_451delCA, c.77T>C

Severe combined immunodeficiency, Athabascan type

Condition Gene/Varient
Severe combined immunodeficiency, Athabascan type Gene:DCLRE1C. Exons: NM_001033855.1:1-7,9-14. Variants(5): c.362+1G>T, c.597C>A, c.972+1G>C, c.917+1G>A, c.780+1delG

Severe Combined Immunodeficiency,T-negative/B-positive type

Condition Gene/Varient
Severe Combined Immunodeficiency,T-negative/B-positive type Gene:JAK3. Exons: NM_000215.3:2-24. Variants(4): c.299A>G, c.1695C>A, c.1333C>T, c.1172_1173insG

Short-Rib Thoracic Dysplasia 2

Condition Gene/Varient
Short-Rib Thoracic Dysplasia 2 Gene:IFT80. Exons: NM_020800.2:2-20. Variants(3): c.2101G>C, c.1646_1648delTAT, c.315C>G

Short-Rib Thoracic Dysplasia 3

Condition Gene/Varient
Short-Rib Thoracic Dysplasia 3 Gene:DYNC2H1. Exons: NM_001080463.1:1-90. Variants(10): c.5959A>G, c.10063G>T, c.5971A>T, c.8512C>T, c.9044A>G, c.4610A>G, c.3719T>C, c.6614G>A, c.1759C>T, c.7382G>T

Shwachman-Diamond Syndrome

Condition Gene/Varient
Shwachman-Diamond Syndrome Gene:SBDS. Exons: NM_016038.2:1,3,5. Variants(7): c.377G>C, c.652C>T, c.258+2T>C, c.258+1G>C, c.183_184delTAinsCT, c.120delG, c.505C>T

Sickle Cell Anemia

Condition Gene/Varient
Sickle Cell Anemia Gene:HBB. Exons: NM_000518.4:1-3. Variants(5): c.19G>A, c.20A>T, c.79G>A, c.364G>A, c.364G>C

Simpson-Golabi-Behmel Syndrome Type 2

Condition Gene/Varient
Simpson-Golabi-Behmel Syndrome Type 2 Gene:OFD1. Exons: NM_003611.2:1-23. Variants(1): c.2126_2129dupAAAG

Sjogren-Larsson syndrome

Condition Gene/Varient
Sjogren-Larsson syndrome Gene:ALDH3A2. Exons: NM_000382.2:1-10. Variants(7): c.1157A>G, c.641G>A, c.521delT, c.809delG, c.943C>T, c.1297_1298delGA, c.1307_1311dupACAAA

SLC6A8-Related Creatine Transporter Deficiency

Condition Gene/Varient
SLC6A8-Related Creatine Transporter Deficiency Gene:SLC6A8. Exons: NM_005629.3:2,5-13. Variants(9): c.1631C>T, c.1011C>G, c.1540C>T, c.395G>T, c.1473C>G, c.1222_1224delTTC, c.1141G>C, c.321_323delCTT, c.1661C>T

Smith-Lemli-Opitz syndrome

Condition Gene/Varient
Smith-Lemli-Opitz syndrome Gene:DHCR7. Exons: NM_001360.2:3-9. Variants(19): c.356A>T, c.724C>T, c.976G>T, c.907G>A, c.1210C>T, c.278C>T, c.744G>T, c.964-1G>C, c.1054C>T, c.453G>A, c.1337G>A, c.1055G>A, c.904T>C, c.725G>A, c.506C>T, c.730G>A, c.832-1G>C, c.1228G>A, c.1342G>A

Spastic paraplegia 5A, autosomal recessive

Condition Gene/Varient
Spastic paraplegia 5A, autosomal recessive Gene:CYP7B1. Exons: NM_004820.3:2-6. Variants(2): c.825T>A, c.187C>T

Spinal Muscular Atrophy

Condition Gene/Varient
Spinal Muscular Atrophy Gene:SMN1. variants(1): EX7 del

Spondylocostal dysostosis 1

Condition Gene/Varient
Spondylocostal dysostosis 1 Gene:DLL3. Exons: NM_016941.3:1-3,5-6,8. Variants(2): c.1511G>A, c.712C>T

Spondyloepimetaphyseal Dysplasia

Condition Gene/Varient
Spondyloepimetaphyseal Dysplasia Gene:MATN3. Exons: NM_002381.4:2-8. Variants(1): c.910T>A

Stickler Syndrome Type IV

Condition Gene/Varient
Stickler Syndrome Type IV Gene:COL9A1. Exons: NM_001851.4:1-38. Variants(1): c.883C>T

Stuve-Wiedemann Syndrome

Condition Gene/Varient
Stuve-Wiedemann Syndrome Gene:LIFR. Exons: NM_002310.5:2-20. Variants(4): c.2013_2014insT, c.653dupT, c.1789C>T, c.171174delTAAC

Succinic Semialdehyde Dehydrogenase Deficiency

Condition Gene/Varient
Succinic Semialdehyde Dehydrogenase Deficiency Gene:ALDH5A1. Exons: NM_001080.3:2-10. Variants(3): c.1234C>T, c.612G>A, c.1226G>A

Sulfite Oxidase Deficiency

Condition Gene/Varient
Sulfite Oxidase Deficiency Gene:SUOX. Exons: NM_000456.2:4-6. Variants(2): c.794C>A, c.650G>A

Tay-Sachs Disease

Condition Gene/Varient
Tay-Sachs Disease Gene:HEXA. Exons: NM_000520.4:1-14. Variants(30): c.409C>T, c.1073+1G>A, c.1260G>C, c.1453T>C, c.116T>G, c.672+1G>A, c.1444G>A, c.1511G>A, c.915_917delCTT, c.1510delC, c.509G>A, c.540C>G, c.1177C>T, c.508C>T, c.1274_1277dupTATC, c.772G>C, c.78G>A, c.1510C>T, c.987G>A, c.805+1G>A, c.532C>T, c.1495C>T, c.1421+1G>C, c.1496G>A, c.533G>T, c.749G>A, c.1176G>A, c.533G>A, c.805G>A, c.1A>G

T-cell immunodeficiency, Congenital alopecia, and Nail dystrophy

Condition Gene/Varient
T-cell immunodeficiency, Congenital alopecia, and Nail dystrophy Gene:FOXN1. Exons: NM_003593.2:1-8. Variants(1): c.763C>T

Tetrahydrobiopterin (BH4)-deficient hyperphenylalaninemia (HPA)

Condition Gene/Varient
Tetrahydrobiopterin (BH4)-deficient hyperphenylalaninemia (HPA) Gene:PTS. Exons: NM_000317.2:1-6. Variants(1): c.286G>A

TMEM67-Related COACH Syndrome

Condition Gene/Varient
TMEM67-Related COACH Syndrome Gene:TMEM67. Exons: NM_153704.5:1-28. Variants(2): c.2498T>C, c.1769T>C

Tyrosinemia Type I

Condition Gene/Varient
Tyrosinemia Type I Gene:FAH. Exons: NM_000137.2:1-14. Variants(13): c.1090G>T, c.47A>T, c.554-1G>T, c.1069G>T, c.786G>A, c.836A>G, c.1141A>G, c.782C>T, c.103G>A, c.1062+5G>A, c.1027G>T, c.698A>T, c.1009G>A

Tyrosinemia Type II

Condition Gene/Varient
Tyrosinemia Type II Gene:TAT. Exons: NM_000353.2:2-12. Variants(5): c.169C>T, c.1085G>T, c.668C>G, c.236-5A>G, c.1249C>T

Tyrosinemia Type III

Condition Gene/Varient
Tyrosinemia Type III Gene:HPD. Exons: NM_002150.2:1-14. Variants(3): c.1005C>G, c.774T>G, c.600C>G

Usher Syndrome Type 1B

Condition Gene/Varient
Usher Syndrome Type 1B Gene:MYO7A. Exons: NM_000260.3:2-49. Variants(8): c.635G>A, c.448C>T, c.1884C>A, c.5227C>T, c.6025delG, c.634C>T, c.1996C>T, c.3504-1G>C

Usher Syndrome Type 1C

Condition Gene/Varient
Usher Syndrome Type 1C Gene:USH1C. Exons: NM_153676.3:1-27. Variants(1): c.238_239insC

Usher Syndrome Type 1D

Condition Gene/Varient
Usher Syndrome Type 1D Gene:CDH23. Exons: NM_022124.5:2-70. Variants(8): c.7823G>A, c.193delC, c.6050-9G>A, c.4504C>T, c.288+1G>A, c.9565C>T, c.4488G>C, c.7224+5G>A

Usher Syndrome Type 1F

Condition Gene/Varient
Usher Syndrome Type 1F Gene:PCDH15. Exons: NM_033056.3:2-33. Variants(5): c.3718-2A>G, c.733C>T, c.7C>T, c.1940C>G, c.1088delT

Usher Syndrome Type 1G

Condition Gene/Varient
Usher Syndrome Type 1G Gene:USH1G. Exons: NM_173477.2:1-3. Variants(5): c.113G>A, c.143T>C, c.394_395insG, c.832_851delTCGGACGAGGACAGCGTCTC, c.186_187delCA

Usher Syndrome Type 2A

Condition Gene/Varient
Usher Syndrome Type 2A Gene:USH2A. Exons: NM_206933.2:2-72. Variants(15): c.14803C>T, c.5975A>G, c.9799T>C, c.2209C>T, c.779T>G, c.2898delG, c.4338_4339delCT, c.12574C>T, c.9424G>T, c.2299delG, c.2276G>T, c.920_923dupGCCA, c.11864G>A, c.8981G>A, c.956G>A

Usher Syndrome Type 2C

Condition Gene/Varient
Usher Syndrome Type 2C Gene:GPR98. Exons: NM_032119.3:1-90. Variants(8): c.17668_17669delAT, c.18131A>G, c.8790delC, c.8713_8716dupAACA, c.2258_2270delAAGTGCTGAAATC, c.5357_5358delAA, c.17137delG, c.6901C>T

Usher Syndrome Type 3A

Condition Gene/Varient
Usher Syndrome Type 3A Gene:CLRN1. Exons: NM_174878.2:1-3. Variants(7): c.449T>C, c.118T>G, c.144T>G, c.528T>G, c.459_461delATT, c.189C>A, c.359T>A

Vitamin D-resistant Rickets Type IIA

Condition Gene/Varient
Vitamin D-resistant Rickets Type IIA Gene:VDR. Exons: NM_001017535.1:4-11. Variants(7): c.915C>G, c.137G>A, c.1036G>A, c.88C>T, c.454C>T, c.239G>A, c.885C>A

VLDLR-Associated Cerebellar Hypoplasia

Condition Gene/Varient
VLDLR-Associated Cerebellar Hypoplasia Gene:VLDLR. Exons: NM_003383.3:2-19. Variants(3): c.1342C>T, c.2339delT, c.769C>T

Waardenburg Syndrome Type 3

Condition Gene/Varient
Waardenburg Syndrome Type 3 Gene:PAX3. Exons: NM_181457.3:1-8. Variants(2): c.251C>T, c.268T>C

Waardenburg Syndrome Type 4A

Condition Gene/Varient
Waardenburg Syndrome Type 4A Gene:EDNRB. Exons: NM_000115.3:2-8. Variants(2): c.548C>G, c.828G>T

Waardenburg Syndrome Type 4B

Condition Gene/Varient
Waardenburg Syndrome Type 4B Gene:EDN3. Exons: NM_207034.1:2-5. Variants(1): c.262_263delGCinsT

Warburg Micro Syndrome 1

Condition Gene/Varient
Warburg Micro Syndrome 1 Gene:RAB3GAP1. Exons: NM_012233.2:1-24. Variants(5): c.1410C>A, c.2011C>T, c.1734G>A, c.748+1G>A, c.899+1G>A

Wilson Disease

Condition Gene/Varient
Wilson Disease Gene:ATP7B. Exons: NM_000053.3:1-21. Variants(174): c.1772G>A, c.2131G>A, c.1369C>T, c.3646G>A, c.3359T>A, c.3903+1delG, c.2304_2305insG, c.3665A>T, c.2887C>T, c.1847G>A, c.3451C>T, c.1646T>C, c.2230T>C, c.2279C>T, c.3877G>A, c.2930C>T, c.2865+1G>A, c.3140delA, c.2828G>A, c.3818C>A, c.3505A>G, c.2827G>A, c.2009_2015delATATGCT, c.3713_3714delAA, c.314C>A, c.3436G>A, c.2662A>C, c.2293G>A, c.1639delC, c.3506T>C, c.1947-2A>G, c.3955C>T, c.397delT, c.2810delT, c.3402delC, c.4022-2A>G, c.1745_1746delTA, c.2122-8T>G, c.3412+1G>A, c.3091A>G, c.3244G>T, c.2463delC, c.2731-2A>G, c.3556G>A, c.3207C>A, c.2605G>A, c.2604delC, c.3659C>T, c.1924G>C, c.3182G>A, c.3699+1G>C, c.2519C>T, c.2335T>G, c.2297C>G, c.1708- 5T>G, c.122A>G, c.2975C>A, c.2513delA, c.1958C>A, c.3517G>A, c.3895C>T, c.3061-12T>A, c.3147delC, c.2332C>G, c.2305A>G, c.2575+2T>C, c.2924C>A, c.3449delA, c.2132G>A, c.3840_3841insTAG, c.865C>T, c.4114C>T, c.813C>A, c.2862_2865delTCCT, c.1846C>T, c.3053C>T, c.3097A>G, c.3731delT, c.1475T>C, c.2356-2A>G, c.3104G>T, c.2071G>A, c.2899A>T, c.3191A>C, c.1340_1343delAAAC, c.3084_3085delGA, c.2755C>G, c.3317T>A, c.654_655delCC, c.3694A>C, c.3829C>T, c.448_452delGAGGG, c.1531C>T, c.343C>T, c.1470C>A, c.2447+2T>A, c.3800A>C, c.1436delC, c.3784G>T, c.3305T>C, c.1968C>A, c.4195delC, c.2804C>T, c.2223T>A, c.2659delG, c.2407G>A, c.2337G>A, c.2304delC, c.1934T>G, c.2695A>T, c.4021G>A, c.2866-6T>G, c.3904-2A>G, c.802_808delTGTAAGT, c.3008C>T, c.3128T>C, c.2333G>A, c.2108G>A, c.4088C>T, c.4112T>C, c.892delC, c.2871delC, c.3796G>A, c.213_214delAT, c.2294A>G, c.2333G>T, c.3263T>A, c.1568T>A, c.3700-2A>T, c.3060+5G>T, c.3190G>A, c.2129G>C, c.3086C>T, c.3532A>G, c.254G>T, c.2623G>A, c.3643G>T, c.3886G>A, c.1186G>T, c.1782delT, c.2762G>A, c.2998G>A, c.2807T>A, c.2532delA, c.2795C>A, c.2121+3A>G, c.2128G>A, c.2438_2440delTAAinsAT, c.2975C>T, c.2572A>G, c.3301G>A, c.3809A>G, c.2621C>T, c.328C>T, c.3443T>C, c.3122G>C, c.561T>A, c.3598C>T, c.2336G>A, c.453delC, c.3111delC, c.3548C>G, c.3007G>A, c.1995G>A, c.1630C>T, c.2123T>C, c.3295G>A, c.845delT, c.2906G>A, c.331C>T, c.2383C>T, c.3722C>T, c.2570T>C, c.3029A>C

Wiskott-Aldrich Syndrome

Condition Gene/Varient
Wiskott-Aldrich Syndrome Gene:WAS. Exons: NM_000377.2:1-12. Variants(4): c.257G>T, c.257G>A, c.244T>C, c.100C>T

Wolcott-Rallison Syndrome

Condition Gene/Varient
Wolcott-Rallison Syndrome Gene:EIF2AK3. Exons: NM_004836.5:2-17. Variants(2): c.1763G>A, c.994G>T

Wolfram Syndrome

Condition Gene/Varient
Wolfram Syndrome Gene:WFS1. Exons: NM_006005.3:2-8. Variants(6): c.676C>T, c.1511C>T, c.1944G>A, c.2084G>T, c.2171C>T, c.2455C>T

Xeroderma Pigmentosum Group A

Condition Gene/Varient
Xeroderma Pigmentosum Group A Gene:XPA. Exons: NM_000380.3:2-6. Variants(4): c.348T>A, c.323G>T, c.619C>T, c.682C>T

Xeroderma Pigmentosum Group B

Condition Gene/Varient
Xeroderma Pigmentosum Group B Gene:ERCC3. Exons: NM_000122.1:2-15. Variants(3): c.1273C>T, c.296T>C, c.1633C>T

Xeroderma Pigmentosum Group D

Condition Gene/Varient
Xeroderma Pigmentosum Group D Gene:ERCC2. Exons: NM_000400.3:2-23. Variants(4): c.1621A>C, c.2047C>T, c.1454T>C, c.2176C>T

Xeroderma Pigmentosum Group E

Condition Gene/Varient
Xeroderma Pigmentosum Group E Gene:DDB2. Exons: NM_000107.2:1-10. Variants(4): c.919G>T, c.937C>T, c.730A>G, c.818G>A

Xeroderma Pigmentosum Group F

Condition Gene/Varient
Xeroderma Pigmentosum Group F Gene:ERCC4. Exons: NM_005236.2:1-11. Variants(4): c.1730dupA, c.2281_2284delTTTG, c.706T>C, c.1765C>T

Xeroderma Pigmentosum Group G

Condition Gene/Varient
Xeroderma Pigmentosum Group G Gene:ERCC5. Exons: NM_000123.3:1-15. Variants(12): c.2620G>A, c.526C>T, c.2170delT, c.215C>A, c.2878G>T, c.2573T>C, c.2972delT, c.1494delA, c.2751delA, c.406C>T, c.787C>T, c.1115_1118delGGAA

X-Linked Adrenal Hypoplasia Congenita

Condition Gene/Varient
X-Linked Adrenal Hypoplasia Congenita Gene:NR0B1. Exons: NM_000475.4:1-2. Variants(22): c.813C>G, c.591C>A, c.788T>A, c.704G>A, c.1319A>T, c.315G>C, c.273C>A, c.513G>A, c.1107G>A, c.1169delA, c.847C>T, c.1316T>G, c.1138T>G, c.388_389delTA, c.873G>C, c.1183C>T, c.800G>C, c.1142T>A, c.109C>T, c.890T>C, c.1146G>T, c.1197C>A

X-Linked Adrenoleukodystrophy

Condition Gene/Varient
X-Linked Adrenoleukodystrophy Gene:ABCD1. Exons: NM_000033.3:1-7,10. Variants(12): c.443A>G, c.1390C>T, c.1451C>G, c.1202G>A, c.1552delC, c.1415_1416delAG, c.1165C>G, c.1252C>T, c.871G>A, c.1552C>T, c.1429G>T, c.796G>A

X-Linked Agammaglobulinemia

Condition Gene/Varient
X-Linked Agammaglobulinemia Gene:BTK. Exons: NM_000061.2:2-19. Variants(28): c.1559G>A, c.1838G>A, c.1082A>G, c.1820C>A, c.1275C>A, c.1685G>C, c.83G>A, c.1223T>C, c.1684C>T, c.43C>T, c.1906G>T, c.1766A>G, c.862C>T, c.763C>T, c.1741T>C, c.1506C>A, c.37C>T, c.1773C>A, c.718G>T, c.755G>A, c.1574G>A, c.1558C>T, c.1288A>G, c.1001A>C, c.338T>A, c.97A>C, c.919A>G, c.2T>C

X-Linked Centronuclear Myopathy

Condition Gene/Varient
X-Linked Centronuclear Myopathy Gene:MTM1. Exons: NM_000252.2:2-15. Variants(4): c.205C>T, c.141_144delAGAA, c.721C>T, c.670C>T

X-linked Charcot-Marie-Tooth disease 5

Condition Gene/Varient
X-linked Charcot-Marie-Tooth disease 5 Gene:PRPS1. Exons: NM_002764.3:1-7. Variants(2): c.344T>C, c.129A>C

X-linked chondrodysplasia punctata 1

Condition Gene/Varient
X-linked chondrodysplasia punctata 1 Gene:ARSE. Exons: NM_000047.2:2-11. Variants(6): c.1743G>A, c.1442C>T, c.1732C>T, c.410G>T, c.119T>G, c.410G>C

X-linked Deafness 1

Condition Gene/Varient
X-linked Deafness 1 Gene:PRPS1. Exons: NM_002764.3:1-7. Variants(4): c.259G>A, c.869T>C, c.916G>A, c.193G>A

X-linked Deafness 2

Condition Gene/Varient
X-linked Deafness 2 Gene:POU3F4. Exons: NM_000307.3:1. Variants(7): c.967C>G, c.990A>T, c.1000A>G, c.499C>T, c.935C>T, c.604A>T, c.950T>G

X-linked Emery-Dreifuss Muscular Dystrophy 1

Condition Gene/Varient
X-linked Emery-Dreifuss Muscular Dystrophy 1 Gene:EMD. Exons: NM_000117.2:1-6. Variants(2): c.631_635delCGTGC, c.547C>A

X-linked Emery-Dreifuss Muscular Dystrophy 6

Condition Gene/Varient
X-linked Emery-Dreifuss Muscular Dystrophy 6 Gene:FHL1. Exons: NM_001449.4:3-7. Variants(4): c.310T>C, c.689-479G>A, c.672C>G, c.625T>C

X-Linked Hyper IgM Syndrome

Condition Gene/Varient
X-Linked Hyper IgM Syndrome Gene:CD40LG. Exons: NM_000074.2:1-5. Variants(9): c.761C>T, c.680G>T, c.107T>G, c.418T>G, c.464T>C, c.632C>A, c.368C>A, c.419G>A, c.703G>C

X-Linked Hypohidrotic Ectodermal Dysplasia

Condition Gene/Varient
X-Linked Hypohidrotic Ectodermal Dysplasia Gene:EDA. Exons: NM_001399.4:1-2,4-8. Variants(9): c.466C>T, c.206G>T, c.826C>T, c.183C>G, c.467G>A, c.463C>T, c.1045G>A, c.725delG, c.573_574insT

X-linked Infantile Spasm Syndrome 1

Condition Gene/Varient
X-linked Infantile Spasm Syndrome 1 Gene:ARX. Exons: NM_139058.2:1,3,5. Variants(2): c.1058C>T, c.81C>G

X-Linked Infantile Spinal Muscular Atrophy

Condition Gene/Varient
X-Linked Infantile Spinal Muscular Atrophy Gene:UBA1. Exons: NM_003334.3:2-26. Variants(3): c.1617G>T, c.1639A>G, c.1731C>T

X-Linked Juvenile Retinoschisis

Condition Gene/Varient
X-Linked Juvenile Retinoschisis Gene:RS1. Exons: NM_000330.3:1-6. Variants(3): c.221G>T, c.214G>C, c.325G>C

X-Linked Leigh Syndrome

Condition Gene/Varient
X-Linked Leigh Syndrome Gene:PDHA1. Exons: NM_000284.3:2-11. Variants(2): c.773A>C, c.787C>G

X-Linked Lymphoproliferative syndrome 1

Condition Gene/Varient
X-Linked Lymphoproliferative syndrome 1 Gene:SH2D1A. Exons: NM_002351.4:1-4. Variants(8): c.95G>C, c.302C>T, c.385T>A, c.172C>T, c.203C>T, c.163C>T, c.164G>T, c.3G>T

X-Linked Ocular Albinism

Condition Gene/Varient
X-Linked Ocular Albinism Gene:GPR143. Exons: NM_000273.2:2-9. Variants(6): c.397T>A, c.695C>A, c.397T>C, c.455G>A, c.992_993insCG, c.816_829delGCAAACAGATATCA

X-Linked Severe Combined Immunodeficiency

Condition Gene/Varient
X-Linked Severe Combined Immunodeficiency Gene:IL2RG. Exons: NM_000206.2:1-8. Variants(10): c.458T>A, c.452T>C, c.923C>A, c.454+1G>A, c.343T>C, c.854G>A, c.865C>T, c.186T>A, c.664C>T, c.355A>T

X-Linked Severe Congenital Neutropenia

Condition Gene/Varient
X-Linked Severe Congenital Neutropenia Gene:WAS. Exons: NM_000377.2:1-12. Variants(3): c.809T>C, c.814T>C, c.881T>C

X-linked Sideroblastic Anemia and Ataxia

Condition Gene/Varient
X-linked Sideroblastic Anemia and Ataxia Gene:ABCB7. Exons: NM_004299.3:1-16. Variants(3): c.1203T>G, c.1234G>C, c.1300G>A

X-linked Sideroblastic Anemia

Condition Gene/Varient
X-linked Sideroblastic Anemia Gene:ALAS2. Exons: NM_000032.4:2-11. Variants(4): c.1354C>T, c.569A>T, c.1427T>A, c.1163C>G

X-Linked Spastic Paraplegia 2

Condition Gene/Varient
X-Linked Spastic Paraplegia 2 Gene:PLP1. Exons: NM_000533.3:1-7. Variants(1): c.409C> T

X-linked Thrombocytopenia

Condition Gene/Varient
X-linked Thrombocytopenia Gene:WAS. Exons: NM_000377.2:1-12. Variants(4): c.1442T>A, c.173C>G, c.167C>T, c.134C>T

2 Variants of g roup B Acyl-CoA Dehydrogenase Deficiency,Short-Chain

Condition Gene/Varient
2 Variants of g roup B Acyl-CoA Dehydrogenase Deficiency,Short-Chain Gene:ACADS. Exons: NM_000017.2:2-10. Variants(1): c.319C>T

Yunis-Varon syndrome

Condition Gene/Varient
Yunis-Varon syndrome Gene:FIG4. Exons: NM_014845.5:1-23. Variants(3): c.1260_1261delGT, c.311G>A, c.831_838delTAAATTTG

Alpha1-Antitrypsin Deficiency

Condition Gene/Varient
Alpha1-Antitrypsin Deficiency Gene:SERPINA1. Exons: NM_000295.4:2-5. Variants(9): c.839A>T, c.347T>A, c.272G>A, c.230C>T, c.194T>C, c.863A>T, c.1096G>A, c.187C>T, c.415G>A

Ataxia With Vitamin E Deficiency

Condition Gene/Varient
Ataxia With Vitamin E Deficiency Gene:TTPA. Exons: NM_000370.3:2-5. Variants(1): c.575G>A

Autosomal Recessive Deafness 1A

Condition Gene/Varient
Autosomal Recessive Deafness 1A Gene:GJB2. Exons: NM_004004.5:2. Variants(4): c.520T>C, c.535G>C, c.551G>A, c.101T>C

Autosomal Recessive Polycystic Kidney Disease

Condition Gene/Varient
Autosomal Recessive Polycystic Kidney Disease Gene:PKHD1. Exons: NM_138694.3:2-67. Variants(3): c.10926G>A, c.5125C>T, c.8581A>G

Beta-thalassemia

Condition Gene/Varient
Beta-thalassemia Gene:HBB. Exons: NM_000518.4:1-3. Variants(17):c.-50-u101C>T, c.-50-u88C>T, c.102_104delGGT, c.182T>A, c.295G>A, c.315+4_315+5delAG, c.315delG, c.316-125A>G, c.316-238C>T, c.316-8T>G, c.344T>C, c.364G>T, c.378_379insCCA, c.382C>T, c.383A>C, c.86T>G, c.92_94dupGGC

Canavan Disease

Condition Gene/Varient
Beta-thalassemia Gene:ASPA. Exons: NM_000049.2:1-6. Variants(2): c.212G>A, c.863A>G Choroideremia. Gene:CHM. Exons: NM_000390.2:1-15. Variants(2): c.1609+1_1609+2insT, c.1609+2_1609+3insT

Duchenne Muscular Dystrophy

Condition Gene/Varient
Duchenne Muscular Dystrophy Gene:DMD. Exons: NM_004006.2:1-79. Variants(1): c.1934A>

G Factor V Leiden thrombophilia

Condition Gene/Varient
G Factor V Leiden thrombophilia Gene:F5. Exons: NM_000130.4:1-25. Variants(1): c.1601G>A

Factor XI Deficiency

Condition Gene/Varient
Factor XI Deficiency Gene:F11. Exons: NM_000128.3:2-15. Variants(6): c.166T>C, c.809A>T, c.901T>C, c.438C>A, c.1716+1G>A, c.403G>T

Familial Mediterranean Fever

Condition Gene/Varient
Familial Mediterranean Fever Gene:MEFV. Exons: NM_000243.2:1-10. Variants(1): c.2084A>G

GLDC-Related Glycine Encephalopathy

Condition Gene/Varient
GLDC-Related Glycine Encephalopathy Gene:GLDC. Exons: NM_000170.2:2-25. Variants(1): c.2405C>T

Glycogen Storage Disease Type II

Condition Gene/Varient
Glycogen Storage Disease Type II Gene:GAA. Exons: NM_000152.3:2-20. Variants(1): c.-32-13T>G

Glycogen Storage Disease Type V

Condition Gene/Varient
Glycogen Storage Disease Type V Gene:PYGM. Exons: NM_005609.2:1-20. Variants(13): c.613G>A, c.2128_2130delTTC, c.1628A>C, c.1621G>T, c.2392T>C, c.1827G>A, c.1094C>T, c.1963G>A, c.255C>A, c.1722T>G, c.148C>T, c.1726C>T, c.1A>G

Hemophilia A

Condition Gene/Varient
Hemophilia A Gene:F8. Exons: NM_000132.3:1-26. Variants(80): c.1660A>G, c.5944T>A, c.6658_6660delGCC, c.6301C>G, c.2059C>T, c.289G>C, c.6658G>C, c.1748A>G, c.5302C>T, c.2225A>G, c.6104T>C, c.2138A>T, c.5422C>T, c.5123G>A, c.5918A>T, c.6533G>A, c.6955C>T, c.1649G>A, c.6790A>G, c.1910A>G, c.979C>G, c.5218A>G, c.6278A>G, c.6113A>G, c.842C>A, c.908C>A, c.5305G>C, c.6021G>A, c.6067G>A, c.5938C>G, c.6532C>T, c.1018G>A, c.1688C>G, c.6920A>C, c.5329C>T, c.1589A>G, c.655G>A, c.6685C>T, c.1679G>C, c.896A>T, c.1992G>C, c.6622C>G, c.1733T>C, c.1280A>T, c.2043G>A, c.6371A>G, c.5093T>C, c.1700T>C, c.5303G>A, c.5305G>A, c.6575G>T, c.669A>T, c.2215G>A, c.1094A>G, c.871G>A, c.5180A>T, c.1736A>C, c.6214C>T, c.5900G>A, c.1930T>G, c.6089G>A, c.1730C>T, c.5954G>A, c.396A>C, c.5558C>T, c.1834C>T, c.2128G>T, c.6956C>T, c.446C>G, c.338A>G, c.1372C>T, c.1309C>T, c.361G>A, c.6932C>A, c.5143C>G, c.6119G>A, c.1648C>T, c.5096A>T, c.5501A>G, c.6787_6788insTTG

Hemophilia B

Condition Gene/Varient
Hemophilia B Gene:F9. Exons: NM_000133.3:1-8. Variants(14): c.391+7A>G, c.1159A>G, c.271T>A, c.1291T>A, c.19A>T, c.793G>A, c.1061G>A, c.1001T>C, c.1298A>C, c.797C>T, c.1265C>A, c.1345C>T, c.1015A>G, c.1009G>A

HFE-Related Hereditary Hemochromatosis

Condition Gene/Varient
HFE-Related Hereditary Hemochromatosis Gene:HFE. Exons: NM_000410.3:1-6. Variants(3): c.845G>A, c.187C>G, c.848A>C

Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency

Condition Gene/Varient
Homocystinuria Caused by Cystathionine Beta-Synthase Deficiency Gene:CBS. Exons: NM_000071.2:3-17. Variants(1): c.1105C>T

Macular degeneration, juvenile

Condition Gene/Varient
Macular degeneration, juvenile Gene:CNGB3. Exons: NM_019098.4:1-18. Variants(2): c.1208G>A, c.1148delC

MTHFR deficiency

Condition Gene/Varient
MTHFR deficiency Gene:MTHFR. Exons: NM_005957.4:2-12. Variants(1): c.665C>T

Nephropathic Cystinosis

Condition Gene/Varient
Nephropathic Cystinosis Gene:CTNS. Exons: NM_004937.2:3-12. Variants(1): c.124G>A

Oculocutaneous Albinism Type 2

Condition Gene/Varient
Oculocutaneous Albinism Type 2 Gene:OCA2. Exons: NM_000275.2:2-24. Variants(1): c.1441G> A

Odontoonychodermal Dysplasia

Condition Gene/Varient
Odontoonychodermal Dysplasia Gene:WNT10A. Exons: NM_025216.2:1-3. Variants(1): c.682T>A

Phenylketonuria

Condition Gene/Varient
Phenylketonuria Gene:PAH. Exons: NM_000277.1:1-13. Variants(24): c.799C>G, c.1256A>G, c.965C>G, c.1241A>G, c.175G>T, c.205C>T, c.307G>A, c.428A>G, c.839A>C, c.365C>A, c.1194A>C, c.1162G>A, c.1117G>A, c.877T>A, c.155T>C, c.512G>C, c.937G>A, c.434A>T, c.1223G>A, c.1139C>T, c.386A>G, c.281T>G, c.1208C>T, c.158G>A

Protein C deficiency

Condition Gene/Varient
Protein C deficiency Gene:PROC. Exons: NM_000312.3:2-9. Variants(6): c.629C>T, c.1335C>G, c.866C>T, c.1000G>A, c.793C>T, c.902C>T

Protein S deficiency

Condition Gene/Varient
Protein S deficiency Gene:PROS1. Exons: NM_000313.3:1-5,8-10,12,14. Variants(2): c.701A>G, c.835C>T

Pseudocholinesterase deficiency

Condition Gene/Varient
Pseudocholinesterase deficiency Gene:BCHE. Exons: NM_000055.2:2-4. Variants(1): c.293A>G

Smith-Lemli-Opitz syndrome

Condition Gene/Varient
Smith-Lemli-Opitz syndrome Gene:DHCR7. Exons: NM_001360.2:3-9. Variants(1): c.1A>

G Stargardt Disease 1

Condition Gene/Varient
G Stargardt Disease 1 Gene:ABCA4. Exons: NM_000350.2:1-50. Variants(27): c.5693G>A, c.5912T>G, c.6320G>A, c.3113C>T, c.6088C>T, c.3322C>T, c.1018T>G, c.1225delA, c.5882G>A, c.5338C>G, c.5908C>T, c.6079C>T, c.2588G>C, c.634C>T, c.3210_3211dupGT, c.5819T>C, c.52C>T, c.3083C>T, c.3106G>A, c.4139C>T, c.1715G>A, c.3364G>A, c.571-2A>G, c.2565G>A, c.3386G>T, c.6148G>C, c.2791G>A

Tay-Sachs pseudodeficiency Disease

Condition Gene/Varient
Tay-Sachs pseudodeficiency Disease Gene:HEXA. Exons: NM_000520.4:1-14. Variants(2): c.745C>T, c.739C>T

TFR2-Related Hereditary Hemochromatosis

Condition Gene/Varient
TFR2-Related Hereditary Hemochromatosis Gene:TFR2. Exons: NM_003227.3:1-18. Variants(14): c.1330G>A, c.750C>G, c.949C>T, c.1469T>G, c.1665delC, c.1861_1872delGCCGTGGCCCAG, c.1186C>T, c.2137-1G>A, c.88_89insC, c.515T>A, c.2069A>C, c.1235_1237delACA, c.2374G>A, c.313C>T

Usher Syndrome Type 1D

Condition Gene/Varient
Usher Syndrome Type 1D Gene:CDH23. Exons: NM_022124.5:2-70. Variants(1): c.5237G>A

Venous Thromboembolism

Condition Gene/Varient
Venous Thromboembolism Gene:F2. Exons: NM_000506.3:1-14. Variants(1): c.*97G>A Xeroderma Pigmentosum Group G. Gene:ERCC5. Exons: NM_000123.3:1-15. Variants(1): c.2375C>T